CONSED 17.0 DOCUMENTATION CONTENTS: WHAT IS NEW IN CONSED 17.0 INSTALLING CONSED<--------------------- QUICK TOUR OF CONSED (INCLUDING SOLEXA AND 454 READS) WHAT IS AUTOFINISH USING AUTOFINISH USING AUTOMATED ADD NEW READS USING AUTOPCRAMPLIFY USING AUTOEDIT USING AUTOREPORT ADVANCED PHRAP/CONSED USAGE NOTE TO LINUX USERS (32 BIT) NOTE TO LINUX USERS (64 BIT) NOTE TO ITANIUM LINUX USERS NOTE TO SGI USERS NOTE TO SOLARIS USERS NOTE TO MACOSX USERS CONSED CUSTOMIZATION CONSED FOR LARGE ASSEMBLIES FOR PROGRAMMERS AND FELLOW TRAVELLERS ONLY MONITORS AND MICE FOR CONSED AUTOFINISH AND PRIMER-PICKING PARAMETERS ACE FILE FORMAT WHAT THE COLORS MEAN TIMESTAMP MISMATCH CONSED REFERENCES ---------------------------------------------------------------------------- WHAT IS NEW IN CONSED 17.0 Solexa and 454 reads are now fully supported. Solexa reads Millions of Solexa reads can be aligned to human-genome sized reference sequences and smaller selected regions viewed in consed. Consed can handle millions of such reads with a chromosome-sized reference sequence with reasonable response times. Reports on variants can be produced or these regions can be conveniently navigated in consed. 454 reads are now fully supported, both as part of Newbler assemblies, and when aligned to a reference sequence. Problems with sff2scf and bringing up the traces are fixed. For experienced consed users who have completed the tutorial before, I suggest you do the new sections of the tutorial which includes the following: USING SOLEXA READS ADDING SOLEXA READS ALIGNING SOLEXA READS AGAINST A LARGE GENOME AND SELECTING A SMALL REGION FOR VIEWING WITH CONSED USING YOUR OWN SOLEXA DATA USING 454 READS (NEWBLER ASSEMBLY) USING 454'S NEWBLER ON YOUR OWN DATA USING 454 READS (ALIGNING TO REFERENCE SEQUENCE ) ADDING ADDITIONAL 454 OR SOLEXA READS SOLEXA AND 454 DATA--WHAT IS HAPPENING BEHIND THE SCENES USING AUTOREPORT ---------------------------------------------------------------------------- INSTALLING CONSED To install Consed, you must have some basic Unix system administration skills. For example, you must be able to run X applications such as xterm, you must know what PATH is for and how to add something to it, you must be able to edit a file using a Unix editor (such as emacs, vi, or pico), you must be able to move around in the filesystem from the command line, and you must know how to build/compile a program. If you do not know how to do these, find someone who does to help you and make sure they finish the job, including completing the tests below. You MUST have the following versions of programs in order to use this version of Consed. If you are using a previous versions of these programs, please upgrade to the following versions. All of these programs come with consed except for phrap, cross_match, phred, and polyphred. Alas, phred, phrap, cross_match, and consed do not come together in a single package. Get phred from bge@u.washington.edu (Brent Ewing) Get phrap and cross_match from phg@u.washington.edu (Phil Green) To request the most recent version of phrap, send an email to phg@u.washington.edu, with a Subject line that says "phrap new version request", and an email body that consists of the following two lines (it should be in exactly this format, to be computer readable): Request: phrap ver 1.080721 or later Registered phrap email address: [[insert address here]] The address should be the one you supplied previously when obtaining phrap; the new version will be sent to it. If you have not previously registered for phrap, or your registered address is no longer valid, you will need to include a license agreement (with all questions answered) in the email. REQUIRED VERSIONS OF PROGRAMS TO WORK WITH CONSED (Note that the versions below are dates. For example, 1.080714 means year 2008, month 07 (July), and 14th day of the month--ignore the leading "1.". Thus 1.080714 is later than 1.080630.) 0.000925.c or later for phred (see above for where to get it) 1.080721 or later for phrap and crossmatch (see above for where to get it) 0.990622.e or later for phd2fasta (supplied with this version of consed) any version of addReads2Consed.perl (supplied with this version of consed) 030415 of phredPhrap (supplied with this version of consed) (Note: if you have an older version of phredPhrap, some of the more recent Consed features, such as miniassemblies, will not work. Note to existing polyphred users: phredPhrap now calls polyphred with different parameters which will cause it to apply different tags than it used to, but these different tags will give it behavior consistent with that described below in CONSED-POLYPHRED INTERACTION. For more information, see http://droog.gs.washington.edu/PolyPhred.html ) 030117 or later for transferConsensusTags.perl (supplied with this version of consed) any version of tagRepeats.perl (supplied with this version of consed) any version of determineReadTypes.perl (or your own custom modified version) 080714 of sff2scf (supplied with this version--discard previous versions or you will be sorry. Type "sff2scf -v" and it should say the correct version. If it instead says: "Error: Unable to open SCF file: ../chromat_dir/-v", your version is old and should be discarded. If you are using polyphred, you must have polyphred 3.5 or more recent. USING AN OLDER VERSION OF POLYPHRED WILL CAUSE SEVERE PROBLEMS WITH CONSED WHICH WILL APPEAR AS PROBLEMS WITH FILETYPES. Everything that comes with this version of Consed should replace any of your files that have the same name (unless you really know what you are doing). In order to run the gauntlet of Phred/phd2fasta/Crossmatch/Phrap, there is a perl script phredPhrap supplied with Consed (above). YOU MUST USE THIS PERL SCRIPT. If you try to run each of these programs directly, you are on your own and you will probably fail. Summary of files you must edit (instructions are below): addReads2Consed.perl determineReadTypes.perl phredPhrap primerCloneScreen.seq primerSubcloneScreen.seq repeats.fasta vector.seq In order to run the gauntlet of phred/phd2fasta/crossmatch/phrap, there is a perl script phredPhrap supplied with Consed (above). YOU MUST USE THIS PERL SCRIPT. If you try to run each of these programs directly, you are on your own and you will probably spend a lot of time needlessly. (Yes, I said this twice.) 1) Using netscape, firefox, or some other browser on the computer of which you used for step 4, open url: http://bozeman.mbt.washington.edu/consed/consed.html#howToGet Click on the appropriate type of computer. Your browser (e.g., netscape) will ask you what you want to name the file. Just use the default. If you are denied access, *carefully* follow the instructions on the "Don't have a cow, man--You are not authorized to get this document" page, including the try-to-get-consed part. Please do not email David Gordon until after you have followed these instructions. 2) Transfer the file to a UNIX (not a Windows) computer. Then type whichever of the following is appropriate for you. (This depends on, in netscape, when you saved the file, what name you gave the file). zcat consed_linux32bit.tar.Z | tar -xvf - zcat consed_linux64bit.tar.Z | tar -xvf - zcat consed_linux_itanium.tar.Z | tar -xvf - zcat consed_mac.tar.Z | tar -xvf - zcat consed_solaris.tar.Z | tar -xvf - zcat consed_solaris_intel.tar.Z | tar -xvf - Note: You must run tar on a UNIX computer--not on an Windows computer, due to a difference in the handling of breaks between lines. 3) I suggest you put Consed, phred, crossmatch, phrap, the perl scripts, and other executables into /usr/local/genome/bin. So create /usr/local/genome/bin and /usr/local/genome/lib If you can't actually use /usr/local/genome, then you could make /usr/local/genome be a link to the real location--that will work just as well. If you want to have another location xxx, then put: setenv CONSED_HOME xxx into the .cshrc (or equivalent if you are using bash or a shell other than csh or tcsh) of all Consed users and create $CONSED_HOME/bin and $CONSED_HOME/lib and put all of these programs into $CONSED_HOME/bin 4) Put the Consed executable in /usr/local/genome/bin (or $CONSED_HOME/bin) Read the appropriate section of this document: NOTE TO SOLARIS USERS, NOTE TO MACOSX USERS, NOTE TO LINUX USERS (32 BIT), NOTE TO LINUX USERS (64 BIT) or (if you are running Linux on an Itanium--a big 64 bit box) NOTE TO ITANIUM LINUX USERS. 5) In /usr/local/genome/bin (or $CONSED_HOME/bin): Type: ln -s (consed executable name) consed where (consed executable name) is the name of one of: consed_linux64bit consed_linux32bit consed_linux_itanium consed_mac consed_solaris consed_solaris_intel This enables you to just use "consed" instead of consed_linux32bit (or whatever) in all commands to consed. It is also important since the scripts refer to "consed" rather than any of the names such as "consed_linux32bit". 6) Make sure that /usr/local/genome/bin (or $CONSED_HOME/bin) is in every Consed users' PATH. 7) Check this by logging on as a user and typing: rehash (don't worry if the rehash command says "not found") consed -V You should see 'Version 17.0'. If you see something else, you have some debugging to do. 8) TESTING CONSED Follow the first few steps of USING CONSED GRAPHICALLY of the QUICK TOUR (below). If you have problems, it may be due to your X emulator. See 'MONITORS AND MICE FOR CONSED' below. If you get some error such as: Error: Can't open display: then the problem probably has nothing to do with Consed, but rather with X. To test this, run some other X application (such as xclock, xterm, xeyes, or xcalc) and see if you get the same error. (If you are running on MACOSX, see NOTE TO MACOSX USERS below.) 9) Build phd2fasta: Go to the misc/phd2fasta directory and type 'make' Move the phd2fasta executable to /usr/local/genome/bin (or $CONSED_HOME/bin) 10) Build mktrace: Go to the misc/mktrace directory and type 'make' (If you get any warnings about "gets", ignore them.) Move the mktrace executable to /usr/local/genome/bin (or $CONSED_HOME/bin) 11) Build the 454 software: Go to the misc/454 directory and type: gcc sff2scf.c -o sff2scf gcc sff2phdball.c -o sff2phdball (or substitute your compiler for gcc) Move executables (sff2scf and sff2phdball) into /usr/local/genome/bin (or $CONSED_HOME/bin) 12) Move all perl scripts from the scripts directory to /usr/local/genome/bin (or $CONSED_HOME/bin) Make sure all are executable (chmod a+x *) 13) Type: perl -v If it says "perl: Command not found.", try to find it. If you really don't have it, get it. You can check where to get perl via the perl web site: http://www.perl.com (If you don't know about perl, try it--it will save you a huge amount of time over developing the same utilities in C, awk, or csh or sh.) Regardless where you put perl, put a link to it in /usr/bin so that all of the scripts with #!/usr/bin/perl will work and you won't have to edit all of them everytime a new Consed release comes out. 14) Create a subdirectory /usr/local/genome/lib (or $CONSED_HOME/lib) 15) In /usr/local/genome/lib (or $CONSED_HOME/lib), put phredpar.dat which comes with phred 16) Create a subdirectory /usr/local/genome/lib/screenLibs. (If you are using a location other than /usr/local/genome for the root of all Phred/Phrap/Consed programs, create $CONSED_HOME/lib/screenLibs). 17) From the misc subdirectory, copy the following files to the directory /usr/local/genome/lib/screenLibs (or $CONSED_HOME/lib/screenLibs). vector.seq repeats.fasta primerCloneScreen.seq primerSubcloneScreen.seq singleVectorForRestrictionDigest.fasta primerCloneScreen.seq is used to screen candidate primers when you use Consed's function "Pick Primer from Clone Template" (on the Aligned Reads Window). primerSubcloneScreen.seq is used to screen candidate primers when you use Consed's function "Pick Primer from Subclone Template" (on the Aligned Reads Window). vector.seq is used to mask the parts of reads that are from vector rather than insert repeats.fasta is used to tag repeats Take a look at these files. They are dummy files indicating the fasta format of the sequences that should be put in them. 18) You should put into primerCloneScreen.seq the vector sequence of the cloning vectors you are using (BAC or cosmid) and into primerSubcloneScreen.seq the sequencing vectors you are using (plasmid, M13, etc). Don't be too generous in putting lots of vectors into the files! The larger they are, the slower primer picking will be. Our files are only this big: -rw-r--r-- 1 root root 29938 Nov 7 1997 primerCloneScreen.seq -rw-r--r-- 1 root root 7381 Aug 13 1997 primerSubcloneScreen.seq and primer picking is quite fast enough. Now that you have set this up, you should try the PRIMER PICKING sections in the Quick Tour (below) to make sure this works. 19) You should put into the file /usr/local/genome/lib/screenLibs/vector.seq (or $CONSED_HOME/lib/screenLibs/vector.seq if you are not using /usr/local/genome for the root of the Phred/Phrap/Consed files.) the vector sequences (in FASTA format) that you want to mask out before running phrap. In general, it is the combination of primerCloneScreen.seq and primerSubcloneScreen.seq. I've given you a dummy file, but you should replace it with your real vector. 20) You should put into the file /usr/local/genome/lib/screenLibs/repeats.fasta (or $CONSED_HOME/lib/screenLibs/repeats.fasta if you are not using /usr/local/genome for the root of the Phred/Phrap/Consed files.) any sequences (in FASTA format) that you want to have automatically tagged. These typically are ALU sequences. If you don't want to tag anything, then comment out (put '#' as the first character of the line) the following lines in phredPhrap: To not tag anything, change: !system( "$tagRepeats $szAceFileToBeProduced" ) || die "some problem running $tagRepeats"; to: #!system( "$tagRepeats $szAceFileToBeProduced" ) # || die "some problem running $tagRepeats"; 21) You should create a file /usr/local/genome/lib/screenLibs/singleVectorForRestrictionDigest.fasta containing the cloning vector sequence. This is used for doing in-silico restriction digests. Thus this cloning vector must start at precisely the site where you cut the (circular) vector to ligate the insert. It is not sufficient to just download the vector sequence from Genbank because they may start the sequence at a different site. To get you started for doing the demonstration, I've provided such a file that will work for the test datasets, but will not work for your own data. 22) SETTING UP TEST DIRECTORIES Copy the test directories and their contents to some location where the users have write access. Copy--do not move them--because the users will occasionally want a fresh copy. I've written the command to make it easy for you to cut/paste from this document to the command line: cp -r 454_newbler align454reads align454reads_answer assembly_view \ autofinish solexa_example solexa_example_answer polyphred standard \ (new_location) cd (new_location) chmod -R a+w * TESTING After installing Consed, you should run all the following tests to make sure you have installed everything correctly: 23) TESTING ADDING SOLEXA READS Follow the 8 steps under "ADDING SOLEXA READS" (below) 24) TESTING ADDING 454 READS Follow the 4 steps under "USING 454 READS (ALIGNING TO REFERENCE SEQUENCE )" (below) 25) TESTING 454 READS (NEWBLER ASSEMBLY) Follow the first 6 steps under "USING 454 READS (NEWBLER ASSEMBLY)" and especially be sure that the traces pop up. 26) TESTING RESTRICTION DIGEST Try the restriction digest feature (RESTRICTION DIGEST below) to make sure this works. 27) TESTING ADD NEW READS It will make your life easier if phred, phrap, and crossmatch are all where Consed expects them: in /usr/local/genome/bin 28) Decide where to put phred's parameter file phredpar.dat and edit both addReads2Consed.perl and phredPhrap to reflect this location. I generally prefer to put it in /usr/local/genome/lib to keep all of the Phred/Phrap/Consed files in one place. Alternatively, you could put it in /usr/local/etc/PhredPar/phredpar.dat which is the historical location of this file. 29) Next you should test the ADD NEW READS step in the Quick Tour (below). This step requires that everything be set up correctly and in the correct location. Hopefully the error messages are clear enough to help you if you have set up anything incorrectly. 30) TESTING RUNNING CROSSMATCH FROM ASSEMBLY VIEW See RUNNING CROSSMATCH FOR SEQUENCE MATCHES (below) and make sure that step works. 31) TEST RUNNING PHREDPHRAP See the section RUNNING PHRED and PHRAP in the Quick Tour (below) 32) TESTING MINIASSEMBLIES See PULLING OUT READS AND RE-ASSEMBLYING THEM (MINIASSEMBLIES) and MINIASSEMBLIES (below) and make sure those steps work. The newer version of phredPhrap is required for this. If you have invested a lot of work customizing some ancient version of phredPhrap (e.g., 10 years old), and don't want to upgrade, you do have the option of keeping your customized version of phredPhrap for regular assemblies, and using the new version of phredPhrap for miniassemblies. To do this, you must specify the alternate name/location of phredPhrap by the .consedrc parameter: consed.fullPathnameOfMiniassemblyScript: /usr/local/genome/bin/phredPhrap (See CONSED CUSTOMIZATION below.) USING YOUR OWN DATA 33) Create the following directory structure, which can be anywhere on any disk: Directory structure: top level directory (generally named after the locus or genome or BAC) subdirectory 'edit_dir'--ace files will automatically be put subdirectory 'solexa_dir'--solexa bustard files *_seq.txt and *_prb.txt go here subdirectory 'sff_dir'--454 sff files go in here subdirectory 'chromat_dir'--chromatograms go in here subdirectory 'phd_dir'--phd files will automatically be put here here subdirectory 'phdball_dir'--phd balls will automatically be put here Put the chromatogram files (e.g., .ab1 or .scf files) into the chromat_dir directory. Keep phd_dir and edit_dir empty. If you already have your chromatograms somewhere else, you can make chromat_dir be a link to wherever you have them. The various phrap and crossmatch files will be put into edit_dir by the phredPhrap script. 34) cd to the edit_dir directory, and type: phredPhrap If you are successful, the script will tell you so. (You can also look in phd_dir and you will see phd files for each of the chromatograms you added in chromat_dir. If the phd files are missing, then phred was unable to call bases from the chromatograms in chromat_dir and you will need to figure out why not). Make sure you are in edit_dir and bring up Consed on the ace file: 35) Bring up Consed as shown in the "QUICK TOUR OF CONSED" consed You should see a file with the extension .ace.1 Double click on it. You should see a list of contigs. Double click on the one you want to see. Follow all of the steps of the QUICK TOUR OF CONSED (below) up to and including viewing traces. The following installation steps are only necessary if you are using phrap, autofinish, or consed's primer picker *and* if you are using Sanger reads: 36) MODIFYING determineReadTypes.perl Read the comments in determineReadTypes.perl Phrap, Consed's primer picking, and Consed/Autofinish all need the following information for each read: is it a univeral primer forward, a universal primer reverse, or a walking read? what is its template name? If you are using different libraries that have different insert sizes, then Consed/Autofinish also need the library name for each read. Generally this information can be determined from the read name, using *your* naming convention. Modify the perl script determineReadTypes.perl to put this information at the end of the phd file using WR info items. If you don't want to do much perl programming and all your libraries have the same insert size, you have the option of using the St Louis naming convention. In this case, you needn't do anything with determineReadTypes.perl You must also uncomment (remove the "#"s in column 1) the lines in the phredPhrap script that say roughly: #print "\n\n--------------------------------------------------------\n"; #print "Now running determineReadTypes.perl...\n"; #print "--------------------------------------------------------\n\n\n"; #!system( "$determineReadTypes" ) || die "some problem running determineReadTypes.perl $!\n"; But what is the St Louis naming convention? Most of it (but not all) is explaned in the file phrap.doc that comes with phrap. In addition, you must never use an underscore in the name if the read is a universal primer forward or universal primer reverse read. If the read is a walk, then you must have an underscore (_) follow the template name and then have a number (the oligo number). Examples of reads in the St Louis naming convention: read eeq03a01.g1.phd.1 is univ rev template: eeq03a01 library: eeq03 read eeq03a02.b1.phd.1 is univ fwd template: eeq03a02 library: eeq03 read eeq03a02.g1.phd.1 is univ rev template: eeq03a02 library: eeq03 read eeq03a03.b1.phd.1 is univ fwd template: eeq03a03 library: eeq03 read eej45h07_2.i1.phd.1 is walk template: eej45h07 library: eej45 read eej46c12_1.i1.phd.1 is walk template: eej46c12 library: eej46 Once you have correctly customized determineReadTypes.perl, then uncomment the line in phredPhrap which calls determineReadTypes.perl It is fine to assume the St Louis naming convention for the purpose of the sample dataset directories that come with Consed ("standard", "assembly_view", "autofinish", and "polyphred"). 37) TROUBLESHOOTING YOUR CHANGES TO determineReadTypes.perl Consed allows you to check that you have correctly modified determineReadTypes.perl: On the Consed Main Window, point to 'Info', hold down the left mouse button, and release on 'Show Info for Each Read'. Study all the information and check that the information presented is correct. If, for example, Consed thinks that there are templates that have 9 or more reads, it is likely that you have not correctly customized determineReadTypes.perl You will see a section that looks like this: template djs736a2_fp04q286 with 2 reads djs736a2_fp04q286.x2 term universal forward (from phd file) djs736a2_fp04q286.y2 term universal reverse (from phd file) You want to see the "from phd file" part. If, instead of "from phd file", it says "inferred from name", that means that determineReadTypes.perl couldn't figure out what kind of read it was. If you think you have made a mistake in customizing determineReadTypes.perl, it is best to delete the PHD files (and phd.ball if you are using that) and run phredPhrap again since the otherwise incorrect WR items will be left in the PHD files. There is more specific documentation within the script determineReadTypes.perl for more information about how to customize it. CUSTOMIZING determineReadTypes.perl: SPECIAL CASES 38) FAKE READS By "fake reads" I mean reads such as those created from a Genbank reference sequence or a consensus from some other assembly... or others for which there is no chromatogram (and there never was any chromatogram). If you don't use any such reads, you can skip this step. In the past, any read that ended with a .a2 or .c3 (where 2 and 3 could be any numbers), was considered a fake read. Now you can make Autofinish not assume this using the .consedrc parameter (see CONSED CUSTOMIZATION): consed.fakeReadsSpecifiedByFilenameExtension: false Instead, you must have determineReadTypes.perl put "fake" into the "type:" field of a "template" WR item. See determineReadTypes.perl for more information. 39) APPENDING EXPID TO THE PHD FILES If you are not using Autofinish, you can skip this step. If you are using Autofinish, and would like Autofinish to tell you how well your reads are succeeding, then the phd files must be appended with the experiment id's. In the 3 Autofinish summary files (*.univReverse, *.univForwards, and *.customPrimers), you will see information like this: univ rev,,,->,-329,-249,71,Contig1,3,djs228_1034 or this: tgaagaaatggctgactcc,56,1,->,3258,3338,3658,Contig1,4,djs228_2813,5,djs228_168,6,djs228_1248 The '3' just before the djs228_1034 on the line starting with "univ rev" is an experiment id. There is also an expid '4' just before djs228_2813, an expid '5' before djs228_168, and an expid '6' just before djs228_1248. Autofinish doesn't know what you will end up calling these reads it is telling you to make. Autofinish only knows those reads by the numbers 3, 4, 5, and 6. So when you make the reads, Autofinish needs to be informed that this is 'experiment 3' or whatever. You do this by appending in the phd file the following structure: WR{ expid addExpid 990811:140818 5 } where WR stands for 'whole read item', expid for 'expid' addExpid is the name of the program that you will write that will append this information 990811:140818 is the date and time in format YYMMDD:HHMISS 5 is the expid This program must be run *after* phred runs to create the phd files. Thus your program must have some method of determining what the expid of each read is. What the University of Washington Genome Center does is to have the finishers put the expid as part of the filename. This makes it easy for a program to look at the phd file and figure out what the expid is and then write the WR item into that phd file. Alternatively, you could keep a database and, after the phd file is created, look into the database to see what the expid is. When you have successfully added expid's to the phd files, the next time you run Autofinish on this project, see the 'EVALUATE' section of the Autofinish output file--you will see lots of interesting information about how well the reads succeeded. ---------------------------------------------------------------------------- QUICK TOUR OF CONSED Release 17.0 Consed is a program for viewing and editing assemblies assembled with the phrap assembly program. If you are already an advanced Consed user, you should read through this and do any of the exercises on features that you are unfamiliar with. I frequently run across people who are doing something in Consed a hard way month after month, and request a new feature to make things easier, when that new feature is already in Consed. If you have never used Consed before, to follow this Quick Tour will take you less than 6 hours. However, it will save you approximately 2 days in agony. If you have 2 extra days to spare, and prefer to waste them in agony, then do not do this Quick Tour and instead immediately skip down to 'INSTALLING CONSED' above. If you do the Quick Tour, start your system administrator installing consed (see INSTALLING CONSED (above)) because you will need to have completed that for some of the more advanced sections of the Quick Tour. When you do the quick tour, I encourage you to be free about changing the data set. If you really mess things up (such as changing all a read's bases to N's), no problem--just delete the data set and start again with a fresh copy. USING CONSED GRAPHICALLY 40) Type the following: cd standard/edit_dir 41) start Consed by typing the appropriate command below (which command depends on what kind of computer you are running on and how your system administrator installed consed--ask him/her): consed consed_linux64bit consed_linux32bit consed_linux_itanium consed_mac consed_solaris consed_solaris_intel (Don't worry about a message like: Warning: Cannot convert string "helvetica" to type FontStruct ) Two windows will appear. One of these will have the list of .ace files and say 'select assembly file to open' and 'standard.fasta.screen.ace.1'. Double click on "standard.fasta.screen.ace.1". The first window goes away. You will now see a list of one contig and a list of reads. This is the 'Consed Main Window'. Double click on 'Contig1'. The 'Aligned Reads Window' will appear. 42) SCROLLING Try scrolling back and forth. Try scrolling by dragging the thumb of the scrollbar. Also try scrolling by clicking on the 4 buttons: << < > >> for scrolling by small amounts. For scrolling by tiny amounts, click on the arrows at either end of the scrollbar. For scrolling by huge amounts, use the middle mouse button and just click on some location on the scrollbar. For scrolling to the beginning or end of the contig, use the <<< or >>> buttons. You can also scroll by 10 bp by using the "<" and ">" on the keyboard (not using the mouse). (Question: why can't you just move the scrollbar to the extreme right in order to go to the end of the contig? Answer: in typical assemblies, there are reads that protrude beyond the beginning of the contig and reads that protrude beyond the end of the contig. Moving the scrollbar to the extreme right will scroll the contig to the end of the rightmost read--typically far to the right of the end of the contig. Thus you should get in the habit of using the <<< and >>> buttons.) GOTO POSITION 43) In the Aligned Reads Window, click in the 'Pos:' box in the upper right-hand corner. Type in a number, such as 540, and push the 'Return' or 'Enter' key. The Aligned Reads Window will scroll to position 540. We find this feature is particularly useful when one person wants another person to look at something in the sequence. 44) COLORS Notice the colors. Scroll to position 937 and notice the read 'a'. The red bases are the ones that disagree with the consensus. Notice the different shades of grey background (around the bases). They refer to the quality (error probability) of the base. Quality values mean the following: A quality value of 10 means 1 error in ten to the 1.0 power A quality value of 20 means 1 error in ten to the 2.0 power A quality value of 30 means 1 error in ten to the 3.0 power A quality value of 40 means 1 error in ten to the 4.0 power and for quality values in between: A quality value of 25 means 1 error in ten to the 2.5 power Get the idea? (These have actually been empirically verified--if you are interested in the gory details, read the phred papers: Ewing B, Hillier L, Wendl M, Green P: Basecalling of automated sequencer traces using phred. I. Accuracy assessment. Genome Research 8, 175-185 (1998). Ewing B, Green P: Basecalling of automated sequencer traces using phred. II. Error probabilities. Genome Research 8, 186-194 (1998). In that same copy of the journal is a paper about Consed, as well.) Also notice the upper and lowercase. This is just a cruder indication of the quality of the bases. 45) To see the quality value of a particular base, point at it and click with the left mouse button. You will see the quality displayed in the Info Box at the bottom of the Aligned Reads Window. These quality values are shown in grey scales: Quality 0 through 4 is given by dark grey Quality 5 through 9 is given by a shade lighter Quality 10 through 14 is given by a shade still lighter . . . Quality of 40 through 97 is given by white (the brightest shade) A quality value of 99 is reserved for bases that have been edited and the user is absolutely sure of the base ('high quality edited'). A quality value of 98 is reserved for bases that have been edited and the user is not sure of the base ('low quality edit'). The ends of the reads shows bases that are grey and have a black background. These are the low quality ends of the reads or the unaligned ends of reads, as determined by phrap. 46) Click on a base on a read. Then hold down the control key and type 'a'. You will move to the beginning of the read. Hold down the control key and type 'e'. You will move to the end of the read. (Emacs users will recognize these commands.) 47) HIGHLIGHTING READ NAMES In the Aligned Reads Window, click on a read name with the left mouse button. The name will turn magenta. Click again and it will turn yellow again. Try turning it magenta and then scrolling. This feature is helpful in keeping track of a particular read as you scroll. If you have an emacs window open (or any editor window), you can paste the read name in by just clicking with the middle mouse button. When you clicked on the read name in the Aligned Reads Window with the left mouse button, the read name was loaded into the paste buffer. 48) DIMMING ENDS OF READS Scroll so that location 490 is about in the middle of the aligned reads window. Push the left mouse button down on the menu item 'Dim'. There will be a list of choices that will appear. Drag the cursor down to 'Dim Nothing' and release. Now look what happened to the color of the bases. The ends of the reads that used to be with a black background now appear red with a grey background. You are seeing the clipped-off bases with all the same information as any other base. Since there is a huge amount of red (discrepant) bases, the screen becomes distracting and busy. Thus by default the low quality clipped-off bases are made with a black background and a grey foreground so they don't distract you. Notice there is a distinction here between 'low quality ends of reads' and 'unaligned ends of reads'. Unaligned ends of reads can be low quality as well, or they can be high quality, as in the case of chimeric reads. Point with the mouse to a read name and hold down the right mouse button. You will notice there is a line that says "high quality from nnn to nnn; aligned from nnn to nnn; chem: prim". This is giving the same information in number form. Highlight the read name first (see HIGHLIGHTING READ NAMES above) so you don't lose the read as you scroll. Then check that the numbers agree with the dimming. You can play with the dimming options a bit. Then return it to 'Dim Low Quality' for the rest of this tour. TRACES AND EDITING 49) Point with the mouse at a base of one of the reads and click with the middle mouse button. (If you have a 2 button mouse, see MONITORS AND MICE FOR CONSED below.) The Trace Window showing the traces for that stretch of read should popup. There are 2 rows of numbers: 'con' are the consensus positions 'rd' are the read positions There are 3 rows of bases in the trace window: 'con' is the consensus 'edt' is where you can edit the base calls of the read 'phd' is the original phred base calls Notice that a red rectangle blinks (the 'cursor') in the corresponding positions of the Aligned Reads Window and the Trace Window. 50) Try editing in the Trace Window. You can click the left mouse button on a base in the 'edt' line to set the cursor (a blinking red rectangle). You can directly overstrike a base by typing a letter. Try this. Try undoing it (by clicking on 'undo' ). If you want to undo more than one edit, you will have to go back to the main Consed window and click on the button labeled 'Undo Edit...'--you will learn that later. You can overstrike with the following characters: acgt (bases), * (a pad, in effect deleting the base), and mrwsykvhdb (IUB ambiguity codes). You can move left and right with the arrow keys. We believe that the user should change a base call only while examining the traces. That is why editing is done here--not in the Aligned Reads Window. 51) You can insert a column of pads by pushing the space bar. Try this. (You may need to click on a base on the 'edt' line first.) (For those of you new to editing assemblies, a 'pad', which in Consed and phrap is represented by the '*' character, is used to align two or more sequences such as these: gttgacagtaatcta gttgacataatcta in which one sequence has an inserted or deleted base with respect to the other. By inserting the pad character, it is possible to get a good alignment: gttgacagtaatcta gttgaca*taatcta This is the purpose of pad character--it is just a placeholder.) You can then overstrike a pad with a base. In this way you can insert a base, and still preserve the alignment. 52) Try highlighting a stretch of a read on the edt line by holding down the middle mouse button and dragging the cursor over some bases. They will turn yellow as you drag. Then release the mouse button. A window will pop up giving you some choices of what to do with those (yellow) bases.: Make High Quality--makes the highlighted bases edited high quality (99). This tells phrap (when it reassembles) that you are sure of the sequence here. Change Consensus--make the highlighted bases edited high quality and change the consensus to agree with that stretch of the read. This is a directive to phrap (upon reassembly) to use that stretch of that read to be the consensus. Make low quality--makes the highlighted bases edited low quality. This tells phrap (when it reassembles) that you are not sure of the bases here and phrap can go ahead and make a join even if the bases in this region don't match perfectly. Make Low Quality to Left End--same as above, but all the way to the left end of the read. Make Low Quality to Right End--same as above, but all the way to the right end of the read. Change to n's--Change the highlighted bases to n's which means they are unknown bases. This tells phrap (when it reassembles) to not make any join based on these bases. It is useful when you believe the bases may be in the chimeric portion of a read. Change to n's to left--same as above but to left end. Change to n's to right--same as above but to right end. Change to x's to left--Change the highlighted bases to x's which means they are vector. This tells phrap to ignore these bases for the purpose of determining overlap. Change to x's to right--same as above but to right end. Add Tag--allows user to add any tag to a stretch of read bases. Dismiss--you decided you don't really want to do anything with this stretch of bases. This popup is made so that nothing else works until you choose something. Try each of these choices, except for tags, which you'll try below. 'Change Consensus' has an additional function--if a read extends out on the right beyond the end of the consensus, you can extend the consensus by using this function. You might want to do this, for example, if crossmatch did not correctly find the cloning site and thus clipped too much. You can add these bases to the consensus by using 'Change Consensus'. Typically, the quality of these bases in the read and in the consensus is 99. That is so that next time phrap runs, it will correctly extend the consensus. However, if you aren't going to reassemble, you might want to just leave the quality values the way phred originally called them. You can do this by using a Consed parameter (consed.extendConsensusWithHighQuality), which you will learn more about later (see CONSED CUSTOMIZATION). 53) To delete a base, overstrike it with a '*' character. (Phrap ignores '*', so this is the same as deleting the character.) If you overstrike all bases in a column with * characters so the entire column consists of *'s (including the consensus base), there is no way to remove the column. This is OK since when you export the consensus (try the exercise on EXPORTING THE CONSENSUS), the *'s are not exported. While you are editing in Consed, we believe there should be a visual indication that a base was deleted. SAVING THE ASSEMBLY 54) To save the assembly, pull down the 'File' menu on the Aligned Reads Window, and release on 'Save assembly'. A box will pop up with a suggested name. I suggest you always use the one it suggests. The idea is that the ace files: (project).fasta.screen.ace.1 (project).fasta.screen.ace.2 (project).fasta.screen.ace.3 (project).fasta.screen.ace.4 (project).fasta.screen.ace.5 are in order of how old they are. If you feel you are taking up too much disk space, then start deleting the ace files starting at the oldest. I do not recommend that you overwrite existing ace files. The version numbers just keep growing, and that is not a problem. EXPORTING THE CONSENSUS 55) Exporting the consensus. Bring the Aligned Reads Window into view again. Hold down the left mouse button on the 'File' menu and release the button on 'Export consensus sequence'. Notice that the consensus will be stored (in this case) in a file called 'Contig1.fasta'. Click 'OK'. There is now a file in your edit_dir directory called 'Contig1.fasta' that has the consensus sequence in it. If you want to see the file, bring up another Xterm (if you are UNIX literate), and type: cd standard/edit_dir more Contig1.fasta 56) Fancier exporting the consensus. Bring the Aligned Reads Window into view again. Hold down the left mouse button on the 'File' menu but this time release on 'Export consensus sequence (with options)...'. Just export a little snip of the consensus, from 400 to 410. (You will notice this contains a pad * character.) Under "Write Both Bases File and Qual File or Just Bases File?" click "Both Files" Click 'OK'. Consed will want to call this file 'Contig1.fasta' again. You can overwrite the existing file. Look in your other Xterm at these files: more Contig1.fasta more Contig1.fasta.qual The one file contains the bases (but no * pads) and the other contains the corresponding qualities of those bases. 57) Exporting the consensus of all contigs at once: Go to the Main Consed Window. Point to 'File', hold down the left mouse button, and release on 'Write all contigs to fasta file'. You then can choose a filename for all contigs to be written to. (In this project there is only 1 contig, so there is no difference between this option and just exporting a contig at a time.) 58) COMPLEMENTING THE CONTIG Push 'Compl Cont' in the Aligned Reads Window to complement the contig. This displays the opposite strand of the contig including the consensus and all reads. Push this button again to uncomplement it. 59) COLOR MEANS EDITED AND TAGS (For this step, first click on the 'Dim' menu and release on 'Dim Nothing'.) Point to the 'Color' menu, hold down the left mouse button and release on 'Color Means Edited and Tags'. Notice that the bases that you have edited (make sure you have edited some bases) will stand out in either white or grey (depending on whether the base was made high quality or low quality). Observe this both in the Trace Window and the Aligned Reads window. This colormode is useful if you are interested in easily spotting which bases are edited. Return to the 'Color Means Quality and Tags' colormode by the following: point to the 'Color' menu, hold down the left mouse button and release on 'Color Means Quality and Tags'. FIND MAIN WINDOW 60) On the Aligned Reads window, click on 'Find Main Win'. This will cause the Consed Main Window to pop up in the event you have buried it under other windows or iconified it. (This may not work with some settings of your X emulator. In that case you will have to find and click on the Main Window to bring it up.) MULTIPLE UNDO EDIT 61) Now that the Consed Main Window is visible, click the 'Undo Edit...' button. There will be a popup indicating the most recent edit. (If it says "no edits so far", then bring up a trace and make several edits. Then click on 'Undo Edit...' again.) Click 'undo'. Then you will see the edit that was done before that. Click 'undo'. You can continue undoing if you like. You now know how to undo more than one edit. You cannot choose which edits to undo and which to not undo--edits can only be undone in precisely reverse order from the order you made them. Once you save the assembly, you cannot undo prior edits. SCROLLING TRACES AND ALIGNED READS TOGETHER 62) In the Aligned Reads window, scroll along the contig to a different point. Click the left mouse button on a read whose trace is already up. Notice that the existing trace instantly scrolls to the corresponding location. Now go to the Trace Window and scroll the traces to a new location. Click on the edt line with the left mouse button. You will notice that the Aligned Reads window will instantly scroll to the corresponding location. Thus you can keep the Aligned Reads window and the traces scrolled to the same location. SHOW ALL TRACES 63) Go to a region where there are lots of reads, say base 1660. Push down the right mouse button and release on 'Display traces for all reads'. You will see all traces displayed in a scrolling window. You can drag the scrollbar on the right down and up to see all the traces. This feature is particularly useful for polymorphism/mutation detection work. This feature was added to work in cooperation with polyphred. (See CONSED-POLYPHRED intereaction below.) In this Traces Window, point at one of the bases of one of the reads and click with the left mouse button. The base should start blinking in red. Now push the down arrow key on your keyboard. The cursor should move to the next read. Repeatedly type the down arrow key. Eventually the display should scroll so you can continue to see the read the cursor is on. Try the up arrow key as well. If there are more than 100 traces at a position, you will see those traces in batches of 100 traces. You can use the bottons at the bottom of the Traces Window labelled "prev 100 traces" and "next 100 traces" to move to the previous and next batches of 100 traces. There is also a button at the top of the Traces Window that changes between "Show All Traves" and "Show Just Good Traces". A "good trace" means a trace that is all of the following: * it has a base at the cursor location * the trace signal is sufficiently good * there is no trag on the read such as a dataNeeded tag that is listed in the resource: consed.showAllTracesDoNotShowTraceIfTheseTagsPresent: EXITING CONSED 64) On the Aligned Reads Window, point to 'File' menu, hold down the left button and release on 'Quit Consed'. If it asks you some questions, answer 'Quit Without Saving and Discard .wrk File'. USING SOLEXA READS You will start with an existing solexa assembly and then, when you have learned some features using solexa reads, you will learn how to create such an assembly yourself. 65) Type: cd solexa_example_answer/edit_dir (You might need to type "cd ../.." first depending on which directory you are currently in.) ls You should see a file ref.ace.1 66) Start consed and double click on "ref.ace.1" In the Contig List, double click on "ref" The Aligned Reads Window should come up. 67) You will notice that reads continue below the bottom of the window. Make the Aligned Reads Window larger by dragging down the bottom right corner of the window. Then make it the original size again. You can also see reads below by scrolling down using the scroll bar on the right side of the Aligned Reads Window. 68) Scroll to position 453. Click on the G consensus base to make a green vertical line appear. Scroll down. You will see that most bases are G but there are some t's, including a high quality T in read s_1_26_207_476 Are there other high quality Ts? You could scroll down to see. But here is a simpler approach: 69) Click again on the G at position 453 in the consensus and scroll back up to the top. Point to the "Misc" menu, hold down the left mouse button and release on 'How to sort reads'. Click on 'by quality' and then click 'Dismiss'. You will notice that now the reads in the Aligned Reads Window are sorted differently--all of the reads that have any base at all at position 453 are at the top, and they are sorted by quality value. It is thus immediately clear that there is only one read with a high quality T at this position. Click on the consensus "T" at position 454 (the neighboring consensus base). Then click back on the consensus "G" at position 453. Switch back and forth between the T and the G. You will notice that the reads are sorted in a different order. That is because some reads have higher quality at position 453 and some have higher quality at position 454. FINDING VARIANTS 70) Click on the 'Find Main Win' button. You should see the Consed Main Window appear (if it was buried beneath other windows). 71) Point to the 'Navigate' menu, hold down the left mouse button, and release on 'Search for highly discrepant positions'. 72) Do not change any of the defaults and just click the 'Search' button. Up will pop a windows labelled 'Highly Discrepant Positions' with a list of the 9 locations below: min # of discrepant reads: 2 min quality: 20 "r": base of reference seq max depth of coverage: 100000 and ignoring reference seq A C G T * pos contig 1 3.1% 0 0.0% 30 93.8%r 1 3.1% 0 0.0% 72 ref 2 5.6% 34 94.4%r 0 0.0% 0 0.0% 0 0.0% 252 ref 2 6.7% 28 93.3%r 0 0.0% 0 0.0% 0 0.0% 338 ref 0 0.0% 0 0.0% 28 93.3%r 2 6.7% 0 0.0% 453 ref 2 6.1% 31 93.9%r 0 0.0% 0 0.0% 0 0.0% 505 ref 2 4.7% 41 95.3%r 0 0.0% 0 0.0% 0 0.0% 742 ref 2 7.1% 26 92.9%r 0 0.0% 0 0.0% 0 0.0% 936 ref 2 7.7% 24 92.3%r 0 0.0% 0 0.0% 0 0.0% 938 ref 0 0.0% 1 2.3% 1 2.3% 41 95.3%r 0 0.0% 982 ref This means, for example, that at position 72 of contig "ref", there is 1 A, 0 C's, 30 G's, 1 T, and 0 *'s (deletions). There are 3.1% A's, 0% C's, 93.8% G's, 3.1% T's, and the reference sequence contains a G at this position 73) Click the 'Next' button on this window and watch the Aligned Reads Window. You can continue clicking the 'Next' button either in the Highly Discrepant Positions Window or else at the bottom of the Aligned Reads Window. Do this until you have reached the end of the list. This provides a rapid method of reviewing variants. 74) Go back to the Consed Main Window, point to the 'Navigate' menu, hold down the left mouse button, and release on 'Search for highly discrepant positions'. When the window pops up entitled 'Navigate by Highly Discrepant Regions', look at the different options. Last time you accepted the defaults. This time try 'Just list indels'. Are there any indel variants in this data set? Try it and see. Well, actually there is one, but you will need to change the "minimum # of discrepant reads" to 1 to find it. Play around with these parameters a little. Here are 2 more obscure options: 'maximum depth of coverage' Typically you won't use this (it is set to a ridiculously high number). It is there in case you want to avoid regions that you believe are collapsed repeats and thus what appear to be variants are really just differences between different copies of repeats. 'Count only first of multiple reads starting at same location' Some people believe that solexa reads that start at exactly the same location are really the same read (the same cluster) and the image software is making multiple reads. If such a group of reads has a discrepancy in it, they want to count the group as one read with the variant rather than multiple reads with the variant. This feature is also available as a report which can be generated automatically without using consed's graphical interface. You will learn how to use consed's report feature later. 75) Go back to the Consed Main Window, point to the 'Navigate' menu, hold down the left mouse button and release on 'Search for high depth of coverage regions'. A Window entitled 'Navigate by High (or Low) Depth of Coverage' should pop up. 76) Change the 'min depth of coverage' box from 10 to 50 and click the 'Search' button. A navigate window entitled 'High Depth of Coverage Regions' will pop up with a number of regions with depth of coverage 50 and over. Navigate to a few of them. 77) You can also see an overview of the depth of coverage. On the Main Consed Window, click on Assembly View. The Assembly View Window will pop up. An error box will come up saying "Sequence matches will not be shown in Assembly View...". Dismiss it for now. You will learn much more about the Assembly View Window later, but for now just notice a few features: 78) Put the pointer on the grey bar with the numbers inside it. Move the pointer left and right and notice the information displayed near the bottom of the Assembly View Window as you do this. In particular, you will see the depth of coverage and the base position change as you move the pointer. * The green graph indicates depth of coverage * There are some very tiny yellow marks (one is just to the right of the 500bp tick mark--the yellow graph indicate density of variants * You will see a magenta line right above the grey bar. This is a graph of the density of indel discrepancies (in this case it is all zero) ADDING SOLEXA READS Now that you know how to view and analyze solexa data, you will learn how to do the alignments with them. 79) Exit Consed and type: cd solexa_example/edit_dir (You may need to first type cd ../.. depending on which directory you are currently in.) ls You should see bustard_files.fof and ref.fa 80) Type: more ref.fa This just contains the reference sequence in fasta format 81) Type more bustard_files.fof It contains just one line for each _seq.txt bustard file. We have just one such file so there is just one line: s_seq.txt s where s_seq.txt is a seq bustard file and 's' is a prefix that will be used with all reads constructed from the sequences in this bustard file. The read name is prefix_lane_tile_X_Y and if you mix different flow cells in the same assembly, it is possible that 2 reads would have the same name other than the prefix. So, when you are using your own data, make the prefix so that different flow cells have different prefixes. Another typical prefix could be FC1180 which is the flow cell name. 82) Type: ls ../solexa_dir You will see 2 bustard files: s_seq.txt and s_prb.txt For each *_seq.txt file, there must be a *_prb.txt file. 83) Convert the reference sequence into an assembly by typing: fasta2Ace.perl ref.fa There should now be a file ref.ace in this directory and a file phd.ball.1 in ../phdball_dir To check that everything is fine, bring up Consed and double click on "ref.ace" You should see an assembly with exactly 1 read--the reference sequence called 'ref'. Terminate Consed. 84) Type: addSolexaReads.perl ref.ace bustard_files.fof ref.fa There will be a flurry of output from various programs ending with something like this: Inserting pads in contigs to accommodate insertions in new reads...Done ending insertPadsInContigs 0 Inserting pads in reads and setting read bases... now saving assembly... 0 writing ./ref.ace.1 See new ace file ref.ace.1 done 0 See log file: ref.080627.111305.out 0.0 minutes to make fasta files 0.0 minutes cross_match time 0.0 minutes consed time 0.0 minutes total time If you instead get error messages, the Consed/cross_match package is not installed correctly. See INSTALLING_CONSED (above). 85) Type: ls You should now see the file ref.ace.1 86) Start Consed and double click on ref.ace.1 Double click on the contig 'ref' in the Contig List. The Aligned Reads Window will popup. Scroll around a little to convince yourself that you have created exactly the same assembly as you used in the exercises above under "USING SOLEXA READS". ALIGNING SOLEXA READS AGAINST A LARGE GENOME AND SELECTING A SMALL REGION FOR VIEWING WITH CONSED In many applications, you will want to align your solexa reads against a large genome (such as the human genome) even though you are only interested in some part of that genome. For example, you might only be interested in reads that do map *best* to the region of interest, and thus you must map them against the entire genome to be sure they don't match better to some other location. Consed handles this by allowing you to run cross_match against a large genome and then allows you to specify certain regions of interest to view with consed. This exercise shows you how to do this. 87) Type: cd selectRegions/edit_dir (You may need to first type cd ../.. depending on which directory you are currently in.) ls You will see: bustard_files.fof which is a list of the solexa Bustard *_seq.txt files and associated prefixes (see above). refs.fof which is a file of filenames of the reference sequences. Typically refs.fof will be a list of the fasta files of the genome such as the human genome, but in this case it contains just one filename, ref.fa which is a small fasta file. (I made it small so it doesn't take you too long to download consed.) regions.txt is a file specifying the regions that you are interested in. 88) Run: alignSolexaReads2Refs.perl bustard_files.fof refs.fof my_alignments.fof (my_alignments.fof will be created by this program--it could be any name) The last line should say "see my_alignments.fof" At this point you have aligned all of the solexa reads against the reference sequence ref.fa (If you want to see those alignments, look in my_alignments.fof and then look in the file it there, and then look through the pages of output for the ALIGNMENT lines.) Now suppose that we are interested in the following two regions: Bases from 1 to 100, and from 901 to 1000. 89) type: more regions.txt This indicates to consed that you are interested in these 2 regions. It also shows the path of the fasta file (ref.fa) which contains the sequence ref. In this case there are only 2 regions specified, but there is no reason, with your own data, that you couldn't specify thousands of regions. 90) type: selectRegions.perl regions.txt my_alignments.fof my_new_ace.ace The last line of the output should say something like: writing my_new_ace.ace.2 91) type: consed -ace my_new_ace.ace.2 You should see 2 contigs: ref_1 and ref_901 which are the 2 regions specified. There should be a total of 245 reads--243 solexa reads and 2 fake fasta file reads. Bring up the Aligned Reads Window and scroll around a bit. For those of you interested in what is happening behind the scenes, you might want to look at the files in phdball_dir: phd.ball.1 contains all 1000 of the solexa reads, phd.ball.2 contains the 2 fake reads representing the 2 regions, and phd.ball.3 contains just the 243 solexa reads that align to the 2 regions. my_new_ace.ace.2 tells consed that it only needs to read phd.ball.2 and phd.ball.3 USING YOUR OWN SOLEXA DATA 92) You first must complete the exercises above using the test solexa data so you are confident you are doing the process correctly. Then create a project directory with subdirectories phdball_dir edit_dir solexa_dir 93) Put the bustard files (pairs of *_seq.txt and *_prb.txt) into solexa_dir (or you could use links or you could even make solexa_dir itself be a link). 94) In edit_dir, make a file myFiles.fof just like bustard_files.fof in the sample dataset described above. (Note the requirement for having a prefix on each line as above.) 95) Make a fasta file myFasta.fa in edit_dir containing the reference sequences. (Note that addSolexaReads.perl is written such that lowercase bases in the reference sequences are assumed to be repeats and matches of solexa reads to such regions are pretty much ignored. If you instead want to not ignore matches to lowercase regions, you must modify addSolexaReads.perl by removing the words "-repeat_screen 2". See phrap.doc which came with the phrap/cross_match.) 96) Convert the fasta file to an assembly by typing fasta2Ace.perl myFasta This should create myFasta.ace 97) Run addSolexaReads.perl like this: addSolexaReads.perl myFasta.ace myFiles.fof myFasta.fa This should create myFasta.ace.1 which should contain all of the aligning solexa reads. USING 454 READS (NEWBLER ASSEMBLY) The Newbler Assembler and Consed work hand-in-glove together. To see a Newbler assembly, exit Consed and type: 98) cd 454_newbler/edit_dir ls (You might need to type "cd ../.." first depending on which directory you are currently in.) 99) Restart Consed 100) Double click on "454Contigs.ace.1" 101) Double click on "contig00001" to bring up the Aligned Reads Window. 102) Using the thumb at the bottom, scroll from the far left of the contig all the way to the far right to get an idea of the assembly. (It is a very small one.) 103) In the Aligned Reads Window, scroll to position 230 and middle mouse click on the t in read EBE03TV01CI9BG.1-240 (which is the top read). A "trace" should pop up. If a trace does not pop up, there is an installation problem. See INSTALLING CONSED (above). Look closely at the error message that pops up and the error message in the xterm where Consed was started. They will indicate where Consed is expecting to find sff2scf and what the problem is. This is a fake trace (unlike the chromatograms from fluorescent sequencers)--the height of the peaks is the actual intensity of the light emitted during each of the 454 cycles. When the light intensity indicates that there is more than one base in a row, instead of having a very tall peak, we break the peak up into n peaks where n is the number of repeated bases. 104) Look at the 2 "A" peaks at positions 232 and 233 in the traces window. Notice that the right peak is higher than the left one. The reason for this is that the intensity of the light emitted was not exactly twice that of a single normal base, so we made the trace show the left peak as high as a standard peak and the height of the right peak is whatever amount of intensity is left over. 105) Scroll the trace window to see the 3 T peaks at position 205. In this case the last peak was shorter than a standard peak. 106) Let's take a look behind the scenes: Terminate consed and examine the contents of ../chromat_dir (it should be empty), ../phd_dir (it should be empty), ../phdball_dir (it should contain phd.ball.1), and ../sff_dir (it should contain reads.sff). Since there are no files in chromat_dir, there are no traces initially. When you click to see a trace, Consed runs the program sff2scf which creates the trace for the read you are interested in by reading reads.sff (which has all the intensity information of each base in each read). Jim Knight of 454 corporation did a great job developing it. Each time a 454 trace pops up, tip your hat to Jim! USING 454'S NEWBLER ON YOUR OWN DATA 107) First you should run through the tutorial above so that you know that everything works with my test dataset. 108) Run Newbler according to the 454 documentation using the -consed option. 109) Delete the .consedrc file that Newbler creates in edit_dir--it is intended for obsolete versions of consed and may cause problems with the current version. 110) Delete the phd.ball link in edit_dir--it is also intended for obsolete versions of consed and may cause problems with the current version. 111) Check that the current version of sff2scf is the one to be used. Type "sff2scf -v" It should say "080714". If instead it says "Error: Unable to open SCF file: ../chromat_dir/-v", your version is old and should be discarded. Use the new version that comes with consed. USING 454 READS (ALIGNING TO REFERENCE SEQUENCE ) Consed/cross_match can quickly align 454 reads to an existing reference sequence. You start with a fasta file of the reference sequence and the 454 sff files. You end up with an assembly with all of the 454 reads aligned against the reference sequence. To do this: Exit Consed and type: 112) cd align454reads/edit_dir (You might need to type "cd ../.." first depending on which directory you are currently in.) ls You will see 2 files: reference.fa which contains the reference sequence sff.fof which is an fof file referring to the 454 sff files (Note that add454Reads.perl is written such that lowercase bases in the reference sequence are assumed to be repeats and matches of 454 reads to such regions are pretty much ignored. If you instead want to not ignore matches to lowercase regions, you must modify add454Reads.perl by removing the words "-repeat_screen 2". See phrap.doc which came with the phrap/cross_match.) You might notice that there also is a align454reads_answer directory parallel to the align454reads directory. This contains the files that you should get if you correctly follow this exercise and have Consed correctly installed. You can refer to it for troubleshooting. Also see INSTALLING CONSED (above). 113) Convert the reference.fa file into an assembly by typing: fasta2Ace.perl reference.fa There should now be a file reference.ace in this directory and a file phd.ball.1 in ../phdball_dir To check that everything is fine, bring up Consed and double click on "reference.ace" You should see that this is a assembly with exactly 1 read--the reference sequence. Terminate Consed. 114) Type: add454Reads.perl reference.ace sff.fof reference.fa There should be lots of output to the screen and no error messages and it should complete in a second or two. Type: ls Now you should see reference.ace.1 115) Bring up Consed and double click on "reference.ace.1" Then double click on contig "myreference" to bring up the Aligned Reads Window. Scroll around a little and middle mouse click on a read or two to see the trace. ADDING ADDITIONAL 454 OR SOLEXA READS You can add additional 454 or solexa reads to an existing assembly. It doesn't matter whether the existing assembly is 454, solexa, or sanger. To add 454 reads, use: add454Reads.perl (existing ace file) (fof of sff files) (fasta) To add solexa reads, use: addSolexaReads.perl (existing ace file) (fof with prefixes) (fasta) In both cases the fasta file must precisely match the consensus of the existing ace file. SOLEXA AND 454 DATA--WHAT IS HAPPENING BEHIND THE SCENES 454 data comes in sff files (in sff_dir) 1. sff files --> phdballs (in phdball_dir) via the program sff2phdball 2. phdballs --> *.fa fasta files (in edit_dir) via the program consed -phdball2fasta 3. fasta files --> *.cross alignments (in edit_dir) via the program cross_match 4. alignments and phdballs --> ace file (in edit_dir) via the program consed -addReads All of the above steps are run by add454Reads.perl For solexa data, all of the steps are the same, except for the 1st step: solexa data comes in *_seq.txt and *_prb.txt "Bustard" files (in solexa_dir) 1. bustard files --> phdball (in phdball_dir) via the program consed -solexa2PhdBall ASSEMBLY VIEW 116) Consed can show you a bird's eye view of the Assembly using forward/reverse pair information, sequence match information, read depth, etc. We have a test database which shows its features. Exit consed and type: cd assembly_view/edit_dir (You might need to type "cd ../.." first depending on which directory you are currently in.) ls Restart consed Double click on "assembly_view.fasta.screen.ace.1" In the Consed Main Window, click on the button "Assembly View" which is near the upper left corner of the window. You should see 3 grey bars with pink labels "2", "3", and "1". The bars are the contigs: Pink "1" means Contig1, pink "2" means Contig2, etc. Notice the scale on the contigs. This gives the contig position. READ DEPTH 117) You should see two graphs above the contig bars: one bright green and one dark green. The dark green graph indicates read depth--the depth of the quality 20 (by default) region of reads. Turn off read depth as follows: Click on the button labelled "What to Show". A menu will popup at that location. Click on the "Read Depth" menu item. A box will appear labelled "Show Read Depth". It has a square (a toggle button) with "show read depth" to the right of the toggle button. Click on the toggle button to change it from appearing pushed in to appearing sticking out. Then click on "Apply". The read depth graph should disappear. If you would like, you can try showing read depth for other qualities other than 20. Note: the read depth is *not* the # of reads that have quality 20 bases or above, although this number is a good approximation. For example, suppose there is a stretch of 300 Q50 bases, and in the middle of that stretch are 5 Q10 bases. Those Q10 bases will be counted toward the Q20 read depth. (In computer science terms, these bases are part of the maximal Q20 read segment.) FORWARD/REVERSE PAIR DEPTH A "forward/reverse pair" is a pair of reads from the same subclone template, each of which is primed within the subclone vector, but one is primed on one side of the insert and the other is primed on the other end of the insert. A forward/reverse pair may both be assembled into the same contig, in which case they should point towards each other and be approximately the insert size apart. A forward reverse pair also might be in different contigs on different sides of a gap. 118) The bright green graph is highest around 7000 to 10000 of Contig2 and around 14000 of Contig3. The bright green graph indicates, for each base, the depth of subclone templates that have a consistent forward/reverse pair. A forward/reverse pair is "consistent" if the forward and reverse are pointing towards each other and are not too far away from each other. ("Too far" is defined as 3 or more standard deviations from the mean of the insert size of templates from a particular library.) In other words, the green graph tells for each base, how many consistent forward/reverse pairs have that base between the forward read and the reverse read. This forward/reverse pair depth is not the same as read depth, which is typically much less. Forward/reverse pair depth is important in that it gives a measure of the confidence of the assembly at a base. If the forward/reverse pair depth is close to zero, as it is in Contig1 position about 9300, there is a likelihood that phrap has made an incorrect join. When the forward/reverse pair depth is zero, the green line turns red, as it does on the right end of Contig3. INCONSISTENT FORWARD/REVERSE PAIRS 119) The red lines connect the right end of Contig3 with the middle of Contig1. These are filtered inconsisent forward/reverse pairs--they are "inconsistent" because they are not consistent (see above) and they are "filtered" in that they have another inconsistent read close by (at both ends) that is inconsistent for the same reason. If two red lines are on top of one another, it is displayed in purple so you know there is more than one there. This is a good example of a misassembly. There are many many reads at the right end of Contig3 that are paired with reads in the middle of Contig1. Notice that the forward/reverse pair depth of Contig1 is close to zero around base 9300. (You can use the "Zoom In" button to see this in more detail, but when you are done experimenting with the Zoom buttons and the scroll bar, click on "Zoom Orig" for the rest of this exercise.) This is where phrap made a bad join. If you tear the contig apart there, complement the left part of Contig1, and then join it to the right end of Contig3, the forward/reverse pairs will change from inconsistent to consistent. You will learn later how to do that. 120) Point to one of the red lines. You will notice that it turns yellow. the box near the bottom of the screen tells you a little more about what you have "highlighted" (turned yellow). If you want more information, click with the left mouse button. A window "Clicked Forward/Reverse Pairs" will appear giving information about each highlighted read. Try this. In the "Clicked Forward/Reverse Pairs" Window double click on one of the reads. The Aligned Reads Window should appear with the cursor on that read. This shows how to go from the Assembly View Window to the Aligned Reads Window. 121) You can also go from the Aligned Reads Window to the Assembly View Window. First you must make sure the Assembly View Window is already open (or else open it by clicking on Assembly View in the Consed Main Window). In the Aligned Reads Window, point to a read name, hold down the right mouse button, and release on "Find Read in Assembly View" (one of the last items in the menu the appears when you push down with the right mouse button). If the read is from a subclone that has a forward/reverse pair in the assembly, then the same "Clicked Forward/Reverse Pairs" Window will appear. It will contain not only the read that you pointed to, but all of the other reads from the same subclone as the one you pointed to. In the Assembly View Window, all of these reads will blink yellow. You can use this procedure to go within the Aligned Reads Window from forward read to reverse read or visa versa. 122) Notice the aqua and purple lines that connect the right end of Contig2 to the left end of Contig3. These are consistent gap-spanning forward/reverse pairs. If there is more than one pair on top of each other, the color is purple. These are the reads that tell you (and Consed, Autofinish, and Phrap) that the right end of Contig2 is connected to the left end of Contig3. As above, point to one to highlight it and click on it to see more information. 123) You can see much more information by clicking on the "What to Show" button, and then when the menu pops up, click on the "Fwd/Rev Pairs" menu item. Up will pop the "Which Fwd/Rev Pairs to Show in Assembly View" Window. Click on "All" next to "Show Inconsistent Forward/Reverse Pairs". Then click "Apply" at the bottom of this window. In this particular example, you just see a few more stray red lines. In a real example, you would probably see so many red lines that it would be a mess. In most cases those inconsistent forward/reverse pairs would be just caused by some laboratory problem (turning a plate around, mislabelling, etc) and not to any misassembly. Thus I suggest that you only generally leave "Show Inconsistent Forward/Reverse Pairs" to "Filtered". 124) Still in the "Which Fwd/Rev Pairs to Show in Assembly View" Window, click on "Show each consistent fwd/rev pair within contigs" (so the button looks as though it is pushed in) and click "Apply". This will show a blue (or purple if there is more than one at a location) square for each consistent forward/reverse pair within a contig. The horizontal position of the square is the center of the subclone (midway between the forward and reverse read) and the vertical position of the square indicates the size of the subclone (higher means a larger subclone). If you really want to see the position of the forward and reverse reads, you can do that too: Click on "Show legs on squares for consistent fwd/rev pairs" ("Show each consistent fwd/rev pair within contigs" must be still on) and click "Apply". What a mess! I believe most of this information is much more easily understood by just showing the "consistent fwd/rev pair depth" (the bright green graph described above). But it is your choice. When you want to highlight a consistent fwd/rev pair, you must point to the square--not the legs. Try it so you understand. 125) Suppose you have an assembly and there are some forward/reverse pairs that you specifically do not want to see in the Assembly View Window. For example, perhaps they are from a plate that was misnamed (or turned around) or from a library that is somehow less reliable. By hiding these forward/reverse pairs, the more reliable/important ones can more easily be seen. This is how you can do that: In the "Which Fwd/Rev Pairs to Show in Assembly View" Window, notice the line that says: Do not show templates in file doNotShowInAssemblyView.fof Underneath this are 3 buttons and probably the one that is selected is "show all templates". Try clicking "do not show specified templates" and click 'Apply'. See if you notice that anything changed in which forward/reverse pairs are displayed. If not, switch back and forth between "show all templates" and "do not show specified templates", each time clicking 'Apply'. When you see a line that appears and disappears, click on it to find what template it is. For example, djs736a2_fp04q146 is one such template. Then from an xterm in the assembly_view/edit_dir directory, type: more doNotShowInAssemblyView.fof You will see the names of the templates that are displayed/hidden. In order to hide particular forward/reverse pairs, put them into this file. This file can also contain the character '*' which means "match any characters". For example, djs736a1_fp* would match the template djs736a1_fp04q206 but not djs736a2_fp01q127 126) Try turning on/off each of the Fwd/Rev Pair options so you understand them. (In this example, there are no "consistent fwd/rev pairs between different scaffolds.") SEQUENCE MATCHES 127) Notice the curvy orange lines connecting Contig1 with Contig2 and Contig3. These show sequence matches. Point at the one connecting Contig1 and Contig2 and click on it. A "Sequence Matches" box will popup saying that this match has 119 bases and has a similarity of 90.8%. Click on that line so its background turns black. Then click on the button "Show Alignment". Up will pop the Compare Contigs Window with the alignment shown in the lower half of this box. You will learn more about this later (see "JOIN CONTIGS"). For now, dismiss this window. 128) In the Assembly View Window, click on "What to Show" and then when the menu pops up, click on "Sequence Matches". In the "Which Sequence Matches to Show in Assembly View" Window, try clicking off "ok to show sequence matches between contigs". Then click the "Apply" button. You should see the orange lines disappear. (Any highlighted lines will not disappear.) Click "ok to show sequence matches between contigs" back on, and click "Apply" and the lines should be back. 129) Also in the "Which Sequence Matches to Show in Assembly View" Window, change the minimum similarity from 90 to 85. Click "Apply". You should see a lot more orange curvy lines, and now you should also see black curvy lines. If you look carefully, you will see that 2 lines within each pair of orange curvy lines do not cross each other but the 2 lines within each pair of black curvy lines do. This is because orange is used to show direct repeats and black is used to show inverted repeats (relative to the orientation of the contigs in the Assembly View Window). 130) Also in the "Which Sequence Matches to Show in Assembly View" Window, click on "filter seq matches by size" and set the min size to 400 and the max size to some huge number (e.g., 1000000) and click "Apply". You will see just one direct repeat (orange curvy lines) of size 745. 131) Try some of the other ways of filtering the sequence matches on "Which Sequence Matches to Show in Assembly View". 132) You must learn this step if you are going to ever see sequence matches with your own data, so don't skip this step. If you have problems, it is likely that the phred/phrap/consed package has not been installed correctly and you will need help from your system administrator. Exit Consed and look at the files in assembly_view/edit_dir. Notice there is a file: assembly_view.fasta.screen.ace.1.aview This is what Consed uses to show sequence matches in the Assembly View Window. When you use your own data, you will not have this file so you will need to learn how to create it. Hide it from Consed by (in practice you will never do this step--this is just to simulate the .aview file not being there): mv assembly_view.fasta.screen.ace.1.aview assembly_view.fasta.screen.ace.1.aview_hide Now restart consed and select ace file assembly_view.fasta.screen.ace.1 If you are asked if you want to apply edits, click the "No" button. Click on "Assembly View" in the Consed Main Window. You will get the error message: "Sequence matches will not be shown in Assembly View because there is no file assembly_view.fasta.screen.ace.1.aview If you want sequence matches to be shown, click on "What to show: Sequence Matches" and then "run crossmatch" 133) RUNNING CROSSMATCH FOR SEQUENCE MATCHES Just as the instructions (above) say, click on "What to show" and then when the popup menu appears, click on "Sequence Matches" and then when the "Which Sequence Matches to Show In Assembly View" Window comes up, click on the "Run Crossmatch" button. Watch the action in the xterm. There should be several pages worth of output from crossmatch that scrolls by in the xterm. If you get an error, it is likely that the phred/phrap/consed package is not correctly installed. You (or your system administrator) should track down the problems and correct them. If you are successful, then 3 orange pairs of curvy lines will appear in the Assembly View Window--the same as you saw in the steps above. PULLING OUT READS AND RE-ASSEMBLYING THEM (MINIASSEMBLIES) When the Assembly View Window indicates, using forward-reverse pair information, that there is a misassembly, Consed provides the tools to correct that misassembly: you can first pull out the the misassembled reads from their current contigs into individual contigs, with a single read per contig. Then you can reassemble those new contigs that each contain a single read. Let's do this: 134) In the Assembly View Window move your cursor so that the red and purple forward/reverse pair lines turn yellow. You will be unable to get them all yellow, but get as many as you can. Then click with the left mouse button. A window labelled "Clicked Fwd/Rev Pairs" should appear with a very long list of reads in it (around 53 reads). 135) In the "Clicked Fwd/Rev Pairs" Window, click on the button labelled "Pull out reads". A window labelled "Put Reads into Their Own Contigs" should appear. 136) In the "Put Reads into Their Own Contigs" Window, select all of the reads. You can do that by clicking with the left mouse button on the first read and then scrolling down to the bottom of the list of reads, holding down the shift key and clicking with the left mouse button on the last read. (When a read is selected, its background should be black.) Click on the button "Remove Highlighted Reads". The Assembly View Window will close and reopen after a few seconds and will complain about not being able to show sequence matches. Save the assembly (see "SAVING THE ASSEMBLY" above) and follow the instructions in "RUNNING CROSSMATCH FOR SEQUENCE MATCHES" (above). The assembly will now probably contain 4 contigs: 2-3-1c in one scaffold and 4 in the other. That is because when the misassembled reads were pulled out of Contig1, it fell into two new contigs: the new contig 1 and contig 4. All of the reads you pulled out have created Contig5, Contig6, ... and approximately Contig58, each of which contain only a single read. MINIASSEMBLIES 137) On the Consed Main Window, click the button "Miniassembly". A box will popup labelled "Reassemble Some Contigs". On the left part of the box will be all contigs, from Contig1 to about Contig58. Notice that starting with Contig5 will be contigs that contain only a single read. On the right will be Contig5 through approximately Contig58. You add or delete from the list on the right. For example, to delete Contig5 from the list on the right, click on it, and then click "Clear Highlighted". The right list should now only contain Contig6 through the last contig. Add Contig5 back to the right list by clicking on Contig5 in the left list and then clicking on the button labelled "Move Highlighted to Right". Contig5 will now appear at the bottom of the list on the right. 138) Leave all of these boxes blank: "-minscore", "-minmatch", "-forcelevel", and "other phrap options:". Keep "Put into separate contigs" selected rather than "Disgard from assembly". Click the "Reassemble" button. If you haven't saved the assembly, a box will popup saying "Error You must first save the assembly before making a miniassembly". Follow the instructions you learned above ("SAVING THE ASSEMBLY") to save the assembly. Then click the "Reassemble" button again and watch the action in the xterm. Lots of output from determineReadTypes.perl, phrap, crossmatch will scroll by in the xterm as those programs run. (If they don't, you haven't correctly installed all of the Consed package.) 139) When the miniassembly is complete, a box will popup asking "Would you prefer to discard this miniassembly and reassemble again?" Click the "No" button. 140) On the Consed Main Window, click the "Assembly View" button. Consed will complain about not being able to show Sequence Matches so save the assembly and follow the instructions in "RUNNING CROSSMATCH FOR SEQUENCE MATCHES" (above). In the Assembly View Window in addition to Contig1, Contig2, Contig3, and Contig4, you should see a few more contigs. These are the result of the miniassembly of all those individual reads. CONTIG ARRANGEMENT--REORDER CONTIGS Contigs are arranged by Consed into "scaffolds" using forward/reverse pair information. However, you might have some external information (such as digest information) that tells you a different arrangement. You can use Consed to rearrange the contigs. This new arrangement will be preserved even if you reassemble. 141) Exit Consed and then restart Consed. Double click on "assembly_view.fasta.screen.ace.1" (If a window pops up saying "There is an edit history file ( a .wrk file )...", click the "No" button.) Click on the "Assembly View" button. You will see two scaffolds: one on the top row with Contig2 and Contig3, and one on the bottom row with just Contig1. Now suppose that you believe that Contig2 and Contig1 are connected together instead of Contig2 and Contig3. To do this: 142) Within the Assembly View Window, click on the "Contig Arrangement" button. Up will pop a menu. Click on "Reorder Contigs". A "Reorder Contigs" Window will pop up. Enter the following information: Contig: 2 [Right End] connected to Contig: 1 [Left End] That is, you must enter "2" and "1" in the contig boxes, and you must click on the first "right end" button. Then click on the "Add and Restart Assembly View" button. A warning box will pop up telling you that you are crazy, because there are 12 forward/reverse pairs as evidence that the scaffold as displayed in the Assembly View Window is already correct. Click on "yes"--that you are sure. The Assembly View Window will disappear for a second and reappear, with Consed2 and Contig1 connected together, just as you wanted. CONTIG ORIENTATION 143) Some users want a scaffold oriented a particular way. For example, one user might be working on a particular gene so wants to always view the top strand of that gene. Another user might be finishing a BAC and wants the 5' end of the BAC on the left of the scaffold. Phrap, however, may not respect their wishes and might have contigs complemented from the way the users want to view them. Consed provides a way for the user to indicate his/her desired orientation, and thereafter if phrap complements a contig from that desired orientation, Consed will complement the contig back when Consed starts up. To demonstrate this, exit Consed and then restart Consed. Double click on "assembly_view.fasta.screen.ace.1" In the Consed Main Window, double click on Contig1. You will see read djs736a2_fp02q494.y1 pointing left. But let's suppose that you would rather the Contig be in the other orientation, with read djs736a2_fp02q494.y1 pointing right. In the Consed Main Window, click on Assembly View. Then click on the button labelled "contig arrangement". When a popup menu comes up, click on "Reorient Contigs". The "Reorient Contigs Window" should come up. Highlight the scaffold labelled "1" under "Select a scaffold". Click on "flip scaffold". Then push the button labelled "Apply and Restart Assembly View". There will be an error box complaining about not being able to show sequence matches. To fix that, save the assembly and follow the instructions in "RUNNING CROSSMATCH FOR SEQUENCE MATCHES" (above). In the Consed Main Window, double click on Contig1 so the Aligned Reads Window comes up. Scroll to the right end. You will notice that djs736a2_fp02q494.y1 is now on the right end pointing right. What is the difference between doing this and just complementing the contig, which just requires the click of a button? The difference is that complementing the contig will be undone the next time phrap runs, but using this procedure will be permanent, even if phrap complements the contig. RESTRICTION FRAGMENTS We'll look at this feature in Assembly View after we've learned how to use the Restriction Fragment Window. CONSED-POLYPHRED INTERACTION Polyphred is a program for finding polymorphic sites; it was developed by Debbie Nickerson's group (contact them at http://droog.mbt.washington.edu). We have a test database, 'polyphred', which has had polyphred run on it already. Polyphred has put a polymorphism tag on each polymorphic site. If Consed is running, exit it. Type: cd polyphred/edit_dir (You might need to first type "cd ../.." depending on which directory you are currently in.) ls Restart Consed. Double click on example2.fasta.screen.ace.1 When Consed comes up, you should see 2 contigs. Double click on Contig2 In the Aligned Reads Window, push the left mouse button while pointing to the 'Navigate' menu and release on: 'Toggle feature: when navigating to consensus location, pop up all traces (currently off)' That will turn this feature on. Now push the left mouse button while pointing to the 'Navigate' menu and release on 'Tags'. Up should pop a list of tag types. Double click on 'polymorphism'. Polyphred has already been run so the consensus is tagged with polymorphism tags at each polymorphic site. Up will pop a window labelled 'Polymorphism Tags' with a list of sites. Click on 'Next'. If you correctly followed the instructions above, all the traces should pop up at the first polymorphic site. You may want to reposition the traces window to see it better. Now ignore the original 'Polymorphism Tags' window and instead click on 'Next' in the *traces* window. This will take you to the next polymorphic site. Pretty nice, huh? Dismiss the Traces Window. 144) ALPHABETICAL ORDERING OF READS The reads can be ordered in 3 ways: a) alphabetically b) first all the top strand reads and then all the bottom strand reads. The top strand reads are then ordered by the left end of the reads. Same with the bottom strand reads. c) arbitrarily by a user-provided file (named readOrder.txt by default) Try changing between a) and b). In the Consed Main Window (click on 'Find Main Win' on the Aligned Reads Window if you can't find the Main Consed Window because it is covered up with other windows), pull down the 'Options' menu, and release on 'General Preferences'. Scroll down until you find 'Display reads sorted alphabetically or by strand/left end of read.' Switch it between 'alpha' and 'strand'. Then click 'Apply and Dismiss'. Notice the effect in the Aligned Reads Window. Many polymorphism and mutation detection labs find that alphabetically sorting is most useful, while many genomic sequencing labs find that sorting by strand/left end of read is most useful. If you want to use a user-provided file, you must learn CONSED CUSTOMIZATION (below) with resources: consed.showReadsInAlignedReadsWindowOrderedByFile: true consed.showReadsInAlignedReadsWindowOrderedByThisFile: readOrder.txt After you are done playing with these features, exit Consed and go back to the previous database: cd standard/edit_dir (You might need to first type "cd ../.." depending on which directory you are currently in.) ls Restart Consed. Double click on standard.fasta.screen.ace.1 When it says "There is an edit history file (a .wrk file)...Do you want to apply those edits?", click on "no". Double click on Contig1 to bring up the Aligned Reads Window again in preparation for the next step. NAVIGATING 145) In the Aligned Reads window, pull down the Navigate menu and release on 'Low consensus quality'. You will see a list of locations. Move the 'Low consensus quality' window down so you can see the Aligned Reads window. Repeatedly click on 'Next' until you reach the end of the list. (Low consensus quality means an area in which the bases each have too high probability of being wrong.) This saves you from having to look through large amounts of high quality data trying to find problem areas. There are 2 'Next' buttons--one on the Aligned Reads Window and one on the Low Consensus Quality Window. You can click on either, but it is probably more convenient to use the 'Next' button on the Aligned Reads Window. Thus you can keep the Aligned Reads Window in front with input focus and keep the Low consensus quality window pushed out of the way. You may want to click on the 'Save' button in the Low consensus quality Window to save to a file a copy of this list of problem areas as you work through them. In our experience, this will be the most important navigate list you will use. In fact, finishing partly consists mainly of adding reads and rephrapping until this list is reduced to nothing. 146) Dismiss the Low consensus quality window. Pull down the 'Navigate' menu again and release on 'High quality discrepancies as above, but omitting tagged compressions and G_dropouts'. You will probably notice there are no entries (unless you created some yourself by editing). That is because there are no high quality discrepancies with this dataset. So let's force there to be some by lowering the quality threshold. First, dismiss the High quality discrepancies window. Click on 'Find Main Win'. In the Consed Main Window, pulldown the 'Options' menu and release on 'General Preferences'. Notice that the default for 'Threshold for High Quality Discrepancy' is 40. Change it to 15 and click 'Apply & Dismiss'. Then follow the steps above to bring up the High quality discrepancies menu. Now you will see several entries. Click 'next' repeatedly to go successively to the next high quality discrepancy in the Aligned Reads Window. You can also double click on a particular line in the High quality discrepancies window to go to that location. Alternatively, you can single click on a line and then click the 'Go' button. Dismiss the High quality discrepancies window. 147) Similarly, try the other navigate lists: Unaligned high quality regions (this list will be empty with this data set), Edits, Regions covered by only 1 strand and only 1 chemistry, and Regions covered by only 1 subclone. Unaligned high quality regions are regions in which the traces are high quality so there is no question of the bases, but the region differs so much from other reads that phrap has given up trying to align the region with the consensus. This could be due to a chimeric read, or perhaps the read belongs somewhere else. We believe that regions covered by only 1 subclone should be covered by a 2nd subclone to prevent the possibility of there being a deletion in the single subclone. There are so many different problem lists that you may forget to check one of them and thus miss a serious problem. Thus we combined them all into a single list. This is the first menu item: 'Low Cons/High Qual Discrep/Single Stranded/Single Subclone/Unaligned High'. We suggest you use this list. 148) Also try navigate by tags by selecting 'tags' under navigate: when the Select Tag Type Window appears, double click on 'compression'. (Note that you can't do anything else until you deal with this window.) This gives a list of a particular tag type in a particular contig. 149) There is also a way of getting such a list in *ALL* contigs: Click on 'Find Main Win'. In the Consed Main Window, point to the 'Navigate' menu, hold down the left mouse button, and release on 'Tags in all contigs'. You can continue as in the previous step. (Since there is only one contig, this list will not be any different than the corresponding list for Contig1.) However, this actually gives you a lot more power: you can search not just for one tag type, but for several. Try selecting clicking on several tag types and then clicking 'ok'. (The only problem is that there are only compression tags in this assembly. When you learn how to create tags below, you will be able to search for multiple tag types.) To speed-up selecting tag types, do this: type 'heter' in the box and click 'select'. You will notice that all of the heterozygote tags are selected. Then click 'ok' to find them all. PRIMER-PICKING 150) Go to some location near the right end of the contig, say base 2470. Click with the right mouse button on the consensus and click on either one of the top strand primer choices (either from subclone template or from clone template). Consed will pause a moment, and then there will appear a selection of primers that pass all of Consed's requirements. (If you get an error message, Consed might not have been correctly installed. See INSTALLING CONSED above.) Templates are also chosen for each primer. You may have to scroll the primer list to the right to see the templates. Consed lists these templates in order of quality--all of them will cover the read you want to make. 151) Double click on one of the primers in the Primers Window. That will cause the Aligned Reads Window to scroll to show that oligo in context. Click on 'Accept Primer'. A comment box will pop up. Enter some comment and click 'OK'. Notice that a yellow oligo tag, with a little red end, is created on the consensus for that primer. The red end points in the direction of the oligo. 152) Point to the yellow and press down the right mouse button and then release on 'Tag: oligo ... show more info?' A box will popup with much information about the oligo--all you need to order that oligo and do the reaction. Notice the field: 'Oligo name'. The name should be something like 'standard.1'. 153) If you can't find the oligo, you can find it again using its name. In the Main Consed Window, point to the "Navigation" menu, push down the left mouse button and release on "Search for oligo tags by name". A box will pop up saying "Search for Oligo Tags". Enter "standard.1" (or whatever the name is). Click "search". The Aligned Reads Window will scroll to the location of that tag. (To see this, you must first scroll the Aligned Reads Window so you can't see the tag.) 154) To check whether the primer matches some other location in the assembly, do the following: As before, in the Aligned Reads Window, point to the yellow tag and press down the right mouse button and then release on 'Tag: oligo ... show more info?' A box will popup. Click on the button labelled 'search for oligo bases'. Note that Consed's primer picking will generally (there are some exceptions) not pick primers that match to more than one location. However, if you have added more information and/or reassembled since that primer was picked, there now could be another location that the primer matches to. I would suggest you just accept the first primer in the list. However, if you want to understand the differences, here is the explanation (if you want more information, see Gordon 1998 listed in the consed references). -----matches----- min self false vector qua 4 22 13 50 "4" is a measure of the primer's match to itself or another copy of itself forming a loop or primer-dimer making it less available for priming. Bigger is worse. "22" is a measure of a match to some other location (not the location you want) on the template. Bigger is worse. "13" is a measure of the match to the vector sequence(s) that are in the vector files. Bigger is worse. Typically the vector files are: /usr/local/genome/lib/screenLibs/primerSubcloneScreen.seq or /usr/local/genome/lib/screenLibs/primerCloneScreen.seq but there are .consedrc parameters that allow these files to be some place else. "50" is the minimum consensus quality of the primer. Bigger is better because it gives you greater confidence that the primer sequence is correct at the location you want to prime. When picking primers (above), what is the difference between 'Pick Primer from Subclone Template' and 'Pick Primer from Clone Template'? There are 3 differences: A. which vector file the primers are screened against. In the former case, the primer is screened against the file primerSubcloneScreen.seq and in the latter case against the file primerCloneScreen.seq B. In checking for false matches elsewhere in the assembly, if the template is the whole clone, then Consed must check for false matches in the *entire* assembly, including all other contigs. But if the template is just going to be a subclone, Consed only needs to check elsewhere in that subclone. Actually, to be conservative, Consed checks for false matches +/- the maximum insert size of a subclone. C. If you are picking primers for subclone template, then the primer picker can also pick the subclone templates. If it doesn't find any suitable subclone template, it will reject the primer. (By default, picking of subclone templates is turned on. If you prefer to pick your own templates, and want Consed's primer picker to be much faster, you can turn it off temporarily or permanently. To turn it off temporarily, go to the Consed Main Window, point to the Options menu, hold down the left mouse button and release on 'Primer Picking Preferences'. Scroll down to 'Pick Subclone Templates for Primers' and click 'False'. Click on 'Apply and Dismiss'. To change this permanently, see CONSED CUSTOMIZATION below. Beware: you must correctly customize determineReadTypes.perl for template picking to work. See INSTALLING CONSED above.) If you are interested in the details of primer-picking, see the section 'AUTOFINISH AND PRIMER PARAMETERS' (below). 155) WHEN CONSED CAN'T FIND AN ACCEPTABLE PRIMER Sometimes Consed refuses to pick a primer. This is because it has tried every possible primer and rejected it for one reason or another. If you don't understand why it didn't pick a particular primer, you can ask it as follows: In the Aligned Reads Window, point to the 'Misc' menu, hold down the left mouse button and release on 'Check Primer'. Enter the left and right consensus positions of the primer, check which strand, and whether the primer is to use subclone templates or the whole clone as a template. Consed will tell you all that is wrong with that primer. Try looking at a top strand subclone primer from 2340 to 2360. 156) PICKING PCR PRIMER PAIRS In the Aligned Reads Window, go to the location where you want to pick the first PCR primer, say base 500. Point to the consensus, hold down the right mouse button and release on 'Top Strand PCR Primer'. Then scroll to the location where you want to pick the second PCR primer, say base 2200. Point to the consensus, hold down the right mouse button and release on "Bottom Strand PCR Primer". There will be a pause and then there will be a list of PCR primer pairs. Click on the pair you want and click "Accept Pair". You can modify the parameters for choosing PCR primer pairs by going to the Consed Main Window, pointing to "Options", holding down the left mouse button, and releasing on "Primer Picking Preferences." For example, by default Consed does not display all PCR primer pairs--this would take too long and give you too many. However, you can ask it to show you all such pairs. In the Primer Picking Preferences, scroll down to "Check All PCR Pairs (huge) or Just Sample?" and click on "All". Then click on "Apply and Dismiss". Then pick PCR primers again, as above. Don't be surprised if you get 10,000 or more pairs of primers! (PCR Primers are screened for: melting temperature and length, the melting temperature of the 2 primers must be sufficiently close to each other, each primers must not stick to itself or to the other primer, no mononucleotide repeats, only ACGT's (no n's or ambiguity codes), and primer pair must not amplify any other location. There are many more details...) SEARCH FOR STRING 157) Try the 'Search for String' button (left side of the Aligned Reads Window). Type in a string (such as aaaca), and click 'ok'. There should be a list of 'hits'. Double click on one of the hits (or single click on it and click on 'go'.) Notice that the Aligned Reads Window scrolls to that position and has the cursor on the found string. (It might be complemented.) Dismiss this window. Try this again, only this time in the Search For String Window select 'Search Just Reads'. Then click 'OK'. You will notice there are many more hits. This is because this shows hits in each read, even if they are at the same consensus position. You can also try the approximate match search for string by clicking on 'Approximate' instead of 'Exact'. The 'Per Cent Mismatch' only applies to the Approximate match search. COPY AND PASTE 158) In the Aligned Reads Window, swipe some bases by holding down the left mouse button. You should see the bases turn yellow, at least temporarily. Then click the 'Search for String' button. Use the middle mouse button to paste the bases you have just swiped into the 'Query string:' box. Notice that you can swipe bases either from the consensus or from a read. The search for string is case-insensitive so don't worry about the pasting being upper or lowercase. CORRECTING FALSE JOINS MADE BY PHRAP 159) Phrap may put several reads together that you believe do not belong together. (For example, you may see several high quality discrepancies between the reads.) If you are sure these reads do not belong together, you can force a subsequent reassembly by phrap to not assemble those reads together. You do this by finding a location where there is a high quality discrepancy. Then click on the read with the right mouse button and release on 'Tell phrap not to overlap reads discrepant at this location'. There are no high quality discrepancies with this dataset so Consed won't let you do this. (Try it and see.) However, when you use your own data, you may get the chance! It is possible to automate this procedure using AutoEdit (see USING AUTOEDIT). ADD NEW READS 160) For this to work, your system administrator must have set up everything correctly. (See below in INSTALLING CONSED.) Assuming you have set everything up correctly, you can now experiment with adding reads. From a UNIX prompt, copy the new chromatograms into the chromat_dir directory: cp ../chromats_to_add/* ../chromat_dir Exit Consed and bring it up again using the original ace file standard.fasta.screen.ace.1 If it asks if you want to apply edits, just say 'no'. On the Main Window, click on the Add New Reads button. There will appear a list of files ending with .fof. These are files that contain lists of chromatograms. Double click on 'reads_to_add.fof' (Accept the defaults for the other options in this window.) There should be lots of progress output in the xterm from which you started Consed. When it completes, there will be a Reads Added Window popup with a report of which reads were added. In this case, it should say that 9 reads were successfully added and list them. If you get an error message, look carefully at the full error message in the xterm to diagnose the problem. Probably there is some mistake in how you installed Consed. See INSTALLING CONSED (above). TEAR CONTIG Just so you get the same results as I do, exit Consed and bring it up again using the original ace file standard.fasta.screen.ace.1 If it asks if you want to apply edits, just say 'no'. 161) When phrap really screws up, you may want to just tear the contig apart in several places and then join the pieces back together in a different way. Let's try it: Go to location 1500. Point the mouse at the consensus base at 1500 and push the right mouse button down. Release the button on 'Tear Contig at This Consensus Position'. Up will pop a list of reads with 2 little buttons next to them <- and ->. Leave everything as it is and just click 'Do Tear'. (If you want to play around with which reads goes into which contig, do that another time.) Now you should have 2 Aligned Reads Windows on top of each other. One should contain 'Contig2' and the other 'Contig3'. Dismiss the little window that says 'Tear Complete'. JOIN CONTIGS 162) Now let's join these 2 contigs back together: Click on 'Search for String' and type in the following bases: agctgccatc Click 'OK'. Search for string should find 2 locations, one in Contig2 and one in Contig3: Contig2 (consensus) 1447-1456 (uncomplemented) Contig3 (consensus) 829-838 (uncomplemented) Double click on the first one. The Aligned Reads Window for Contig2 will scroll to location 1447 and the window will raise up. In that Aligned Reads Window, click on 'Compare Cont'. Now double click on the 'Contig3' line in the above Search for String results. The Aligned Reads Window for Contig3 will scroll to location 829 and lift up. In that Aligned Reads Window, click on 'Compare Cont'. Now the Compare Contigs Window should be visible. In the Compare Contigs Window, try scrolling back and forth. You can change the cursors (blinking red), but if you do, please return them to the locations 1447 and 829 for the next step. The cursors 'pin' these bases together when doing an alignment. (The algorithm is a pinned and banded Smith-Waterman alignment.) Click on Align. Try scrolling the alignment by dragging the thumb in the lower half of the Compare Contigs. An 'X' means there is a discrepancy between the 2 contigs. There is also a 'P' (see if you can find it!) The P indicates the bases that you pinned together. You will also notice that some bases are lighter and some are darker. This indicates quality just as in the Aligned Reads Window. You will notice that wherever there an is a discrepancy (an 'X') one of the bases is low quality. This is your cue that the discrepancy is just a base calling error rather than indicating that the two contigs really are different but similar locations. Click a few times on "Next Discrepancy." Then click on "Prev Discrepancy." These buttons will take to to each discrepancy (X). Notice that as you move from X to X in this manner, the Aligned Reads Windows scroll as well. Bring up traces for one of the contigs and see how the traces will scroll also. Click with the left mouse button on either contig in the bottom alignment. You will notice that both contigs will have the red blinking cursor in the same position. Click on 'Scroll Both Aligned Reads Windows' and look at the Aligned Reads Windows to see that they scroll to the corresponding positions. The number of discrepancies and discrepancy rate is also displayed--find this. Finally click 'Join Contigs'. The 2 previous Aligned Reads Windows will disappear and there will be a new one which has a new contig 'Contig4'. You have made a join! Scroll left and right. You will notice that many of the reads are highlighted. These are the reads that came from the previous "right" contig. To unhighlight all of these reads at once, point to the "Misc" menu, hold down the left mouse button and release on "Unhighlight All Reads". It is possible to have more than one Compare Contigs Windows up at a time. This allows you to investigate a repeat that has more than 2 copies. COMPARE CONTIGS WINDOW AND INVERTED REPEATS In the above example, we used the Compare Contigs Window to examine a sequence match between two different contigs. It is also possible to use the Compare Contigs Window to examine a sequence match between two copies of a repeat within the same contig, either direct or inverted. 163) To see this, restart Consed: ../../consed_(computer type) Double click on standard.fasta.screen.ace.1 When it says "There is an edit history file (a .wrk file)...Do you want to apply those edits?", click on "no". Double click on Contig1 to bring up the Aligned Reads Window. Go to position 69 (use the "Pos:" box described above). Click the "Compare Cont" button on the Aligned Reads Window. The Compare Contigs Window will popup, but move it aside. Go to position 2035 in the Aligned Reads Window. Click the "Compare Contig" button again on the Aligned Reads Window. In the Compare Contigs Window there are two copies of Contig1--one on top and one on the bottom. Each has a "complement just in this window" button. Click on the bottom one (the one that has position 2035 blinking red). After clicking on it, you should notice that the numbers on the bottom contig are reversed to they decrease to the right--a copy of Contig1 has been reversed and complemented. Now click the "Align" button. Suddenly, you should see the alignment appear in the bottom half of the Compare Contigs Window. You should see bases between 69-78 aligned against the reversed complement of bases from 2026-2035. This has shown how you explore an inverted repeat. If you wanted to examine a direct repeat, you would use the same method except you wouldn't click on the "complement just in this window" button. Compare Contigs is one method of exploring joins of contigs that were not made by phrap. Another method is to use the Assembly View Window (above). They are designed to work together: the Assembly View Window gives a high level view of all sequence matches and takes you to the Compare Contigs Window which shows the alignment of a single sequence match and, if the user so desires, makes a join. REMOVING READS 164) You can remove individual reads and put them into their own contigs. For example, in the Aligned Reads Window, go to location 2000. Point to the read name of read djs74_2664.s1 and hold down the right mouse button. Release on 'Put read djs74_2664.s1 into its own contig.' Presto-chango! The read is put into its own contig and the old contig is redrawn without the read in it. At this point you should save the assembly--you should always save the assembly after removing reads. 165) You can also remove many reads at once. Look at the Consed Main Window. Click on "Remove Reads". Type into the "File of read names:" box "reads_to_remove.fof" and either push the "Enter" key or click on "Read File". You should see a list of 2 reads: djs74-2231.s1 djs74-3174.s1 You can click back and forth between the choices of "Delete Reads from Assembly" and "Just Put Each Read into Its Own Contig". Try each one. Delete Reads from Assembly means that the read will no longer appear in Consed. When you are using your own data and you really want to remove reads from the assembly, you must also use the UNIX "rm" command to remove the corresponding phd files from phd_dir and the chromatograms from chromat_dir. Otherwise, the next time you run phredPhrap, the reads, like Phoenix, will rise again to become part of the next assembly. After you have completed this exercise, restart Consed so that you have all the reads in their original locations for the following exercises. TAGS 166) Bring up a trace for a read (as above). Swipe some bases on the 'edt' line while holding the middle mouse button down. A list of choices will pop up. Select 'Add Tag'. Type in a comment in the box at the bottom, and select 'comment' from the list of tag types. You will now see a blue box both in the Aligned Reads Window and in the Traces Window on that read. To see the comment, you can just point to it in the Aligned Reads Window and you will see the comment in the lower right hand corner of the Aligned Reads Window. Alternatively, you can click on that blue tag in the Aligned Reads Window with the right mouse button and release on 'Tag: comment Show more info?'. Alternatively, you can click on the blue tag in the Traces Window with the right mouse button. Try creating some other kinds of tags: again swipe some bases in the Trace Window by selecting a different tag type. You will notice that different tags are in different colors. You can always use the methods above to see what kind of tag it is if you forget what a particular color means. Create a tag and enter for the comment 'lazy fox'. Then in the Main Consed Window, push down the left mouse button on 'Navigate' and release on 'Search for tags/find string in comment'. In the box, enter 'fox' and click 'Search'. The tag should appear in a navigation window. In this manner, you can find (and go to) all tags with 'fox' in the comment. You can also define your own tag types. See below CREATING CUSTOM TAG TYPES for how to do that. CREATING LONG TAGS 167) You can create really, really long tags as follows: Just create a short version of the tag as above for where you want the tag to start. Then figure out the consensus position of where you want the tag to end. In the Aligned Reads Window, click on the short tag with the right mouse button and release on 'tag: show more info?' (as above). A Tag Window will appear for that tag. In the Tag Window, simply change the End Unpadded Consensus Position to the place you want it to end. Then click 'OK'. You will now notice that the tag will be as long as you wanted. CONSENSUS TAGS 168) You can create tags on the consensus in the same way. In the Aligned Reads Window, use the middle mouse button to swipe some bases on the consensus in the Aligned Reads Window. Up will pop a list of tag types. Click on one of them. Try it again somewhere else. Try it with the tag type being 'comment'. In this case, you must enter a comment. Notice the pretty colors! If you forget which tag type a particular color represents, just point at the colored tag with the mouse and the tag type will be displayed at the bottom of the Aligned Reads Window. 169) Try creating some tags that overlap each other. You will notice that the overlapping region will be purple. If you want to know which tags overlap, you can use any of the methods already discussed. SEARCH FOR READ NAME 170) Restart Consed using the original ace file standard.fasta.screen.ace.1 If it asks if you want to apply edits, just say 'no'. Instead of clicking on a read or contig name, type a read name into the "Find reads containing (*'s allowed):". If you want to look at the location containing read djs74-2689.s1, you can just type "2689" and then push the "Enter" key and Consed will immediately bring up the Aligned Reads Window with the cursor on read djs74-2689.s1. Suppose that there were more than one read that matched? For example, suppose you type: "26" and then push the "Enter" key. This matches 3 reads: djs74-2689.s1 djs74-2679.s1 djs74-2664.s1 Try it and see what happens... Try entering "26*9" and see what happens. What does the "*" mean? Try using "Find 1st read starting with:". Try typing djs74-2 You will notice that as you type each letter, the first item in the list that matches the letters typed will be highlighted. Experiment with deleting a few letters and typing others. This is a powerful method of quickly getting to the read name you are interested in. When you get to the name in the list, you do not have to type the rest of the name--just type carriage return or else click on 'OK'. ONLINE DOCUMENTATION 171) On the Aligned Reads Window or on the Consed Main Window, click on the 'Help' menu and release on 'Show Documentation'. You will see this document. You can search for keywords in it. It is also on the web. Go to http://bozeman.mbt.washington.edu/consed/consed.html, and find "complete documentation" near the bottom of the page. THE .WRK FILE 172) Consed keeps a log of all changes you make to an assembly: adding new reads, putting reads into their own contigs, making joins and tears, adding and removing tags, and changing bases. This log is kept in a file ending with ".wrk". You can use this file to help you remember exactly what you did to an assembly. 173) You should save your edits by pulling open the 'File' menu on the Aligned Reads Window, and releasing on 'Save assembly'. RESTRICTION DIGEST 174) Restart Consed. Double click on "standard.fasta.screen.ace.1" In the Consed Main Window, click the "Digest" button. For the purpose of this exercise, the full pathname of file of vector sequence can refer to any file of sequence in fasta format. However, when you are using it with your own data it should refer to a file that contains the sequence of your cloning vector. For example, if you are sequencing a BAC, it should contain BAC vector. The sequence must start at the vector/insert junction that you used when you ligated the insert. Click "OK". You will see a comparison of in-silico fragments (those calculated from the sequence) and real fragments (those in fragSizes.txt which supposedly came from a real gel). * If a band is red, that means that it doesn't match. * If a band has a "v" on it, that means it is a vector fragment. * If a band has a "g" on it, that means it is a gap-spanning fragment. Move the pointer over the fragments, and you will see the fragment sizes appear. Move the pointer to the in-silico fragment with size 2299. Click on it. You will see the fragment on the left size of the window become highlighted. Click on the button labeled "right end" (2nd row from the bottom of the window) and the Aligned Reads Window will pop up, with the cursor on the right end of the fragment. Click on "show problems" and navigate through the list of problems by clicking on "next". You will notice that the Gel Window is zoomed in. To return to the original zoom, click on "Zoom Original". Where it says "Select Enzyme:", point to "EcoRV", hold down the left mouse button and release on "HindIII". This is how you change enzymes. Click on the button labeled "Text Output". This can be saved to a file and printed out. Dismiss the restriction digest window. On the Consed Main Window, click the "Digest" button again. Notice the file "fragSizes.txt". This is a file of actual gel fragment sizes. If you don't have an actual gel, but rather you want to just make predictions of fragment sizes from the sequence, you can leave this box blank (erase the "fragSizes.txt"). Try that. fragSizes.txt has the following format: >EcoRV 448 710 1102 1197 -1 >HindIII 448 508 586 735 801 -1 where EcoRV and HindIII are enzymes and the numbers below them are the actual fragment sizes. Each enzyme list is terminated by -1. Consed does its best to try to figure out which end of the clone insert is connected to which end of the vector. However, it sometimes is wrong. If you believe it is wrong, you can click "compl vector" to try connecting the insert to the vector in the opposite orientation and see if that produces better agreement with the actual digest. RESTRICTION DIGEST AND ASSEMBLY VIEW 175) Go to the assembly_view sample dataset and bring up the Assembly View Window: cd assembly_view/edit_dir (You might need to type "cd ../.." first depending on which directory you are currently in.) ls Restart consed Double click on "assembly_view.fasta.screen.ace.1" In the Consed Main Window, click on the button "Assembly View" which is near the upper left corner of the window. Also on the Consed Main Window, click on Digest. The "Select Enzyme and Contigs" Window should appear with EcoRV and HindIII selected. Click OK. The "Display Digest" Window should appear. Now look at the Assembly View Window. You will notice blue, green, and red rectangles under the grey contig bars. These rectangles are the in-silico restriction fragments. Point to one of them-- it will turn yellow and information will be displayed in the information box below. Point to one of the EcoRV fragments, hold down the right mouse button, and release on "Goto fragment in digest window". Notice that in the Display Digest Window, the selected fragment is highlighted both on the left side (the text) and in the Gel (right) side. PROTEIN TRANSLATION AND OPEN READING FRAMES 176) If you would like, you can see the amino acid translation of the consensus in all reading frames. In the Aligned Reads Window, push down the left mouse button on the 'Misc' menu and release on 'Show Top Strand Protein Translation'. Try again but this time release on 'Show Bottom Strand Protein Translation'. Notice that there are 2 characters that are in magenta color. What are those characters? Why are they made in a different color? To not show the protein translation, push down the left mouse button on the 'Misc' menu and release on 'Don't show protein translation'. 177) You can search for open reading frames (a methionine and a stop codon within the same reading frame) within a contig. In the Aligned Reads Window, push the left mouse button on 'Navigate' and release on 'Search for Open Reading Frames'. Notice that the open reading frames are shown for all 6 reading frames and are sorted by length. ERROR RATE 178) In the Aligned Reads Window is a box (upper right) labelled 'Err/10kb'. This is the estimated error rate for this contig, and it is a good indicator of when you are done (or not done) finishing. In addition, you can find the error rate for a particular region of contig as follows: Point at 'Misc' menu, hold down the left mouse button, pull down and release on 'Show Error Info For Region'. Fill in the boxes for left and right consensus position, click on 'Calculate' and you will be given the error and single subclone data for that region. RUNNING PHRED and PHRAP phred and phrap *must* be run via the phredPhrap perl script. If you don't do this, you are on your own. If you run phred on its own, and then you run phrap on its own, you will get an ace file that will not be usable by Consed. After you have run into problems (and you probably will), then do not email us--instead please use the phredPhrap script. To use the phredPhrap script to run phred and phrap: 179) Type: phredPhrap -V It should say: 030326 (or newer). If it does not, then you probably have not installed all the perl scripts from the scripts directory, as directed in INSTALLING CONSED. 180) Make a copy of the standard dataset. E.g., (First go up by typing "cd .." until you see "standard" when you type "ls". Then type: cp -r standard test cd test 181) Delete all the files in phd_dir and edit_dir: rm phd_dir/* rm edit_dir/* 182) cd edit_dir 183) Run phredPhrap by typing phredPhrap That's it--you no longer need to type *any* arguments, and generally you should not. If you want to add phrap options, you can do that: e.g., phredPhrap -forcelevel 3 Then run Consed on the resulting ace file as indicated in the beginning of the Quick Tour (above). If you have any problems, this is the time to diagnose them before you use your own data. COMMON PROBLEMS RUNNING PHREDPHRAP 184) Problems were due to polyphred. To check this, in phredPhrap, leave the following line: $bUsingPolyPhred = 0; This will make polyphred not be used. If the problem then goes away, you will know the problem has something to do with polyphred so do not contact any of the phred/phrap/Consed people. Instead, contact the polyphred people: http://droog.mbt.washington.edu and dpc@u.washington.edu and debnick@u.washington.edu 185) Permission problems. Check that you have write access to the phd_dir and edit_dir directories. You can do this by trying to create a file in those directories: touch ../phd_dir/xxx which creates a file ls -l ../phd_dir/xxx which checks if the file was created. Do the same with ../edit_dir/xxx If you get a permission problem, do not contact me. UNIX permission problems are very simple for anyone who knows UNIX--get someone locally who understands UNIX and can help you solve the permission problem. 186) WHY ARE ALL THE READS NOT IN THE ASSEMBLY? You will notice that there are some contigs that contain only one read. You will also notice that there are some reads that are not shown by Consed at all, since phrap did not put them into the ace file. Why? If a read does not have a significant match (with Smith-Waterman score exceeding minscore) to any other read, that read is not included in the ace file. Instead, that read is put in the '.singlets' file. That read will not appear in Consed. If a read does have a significant match to any other read, then it will appear in the ace file and be shown by Consed. However, such a read might have other problems: it might not be possible to assemble such a read with other reads (in the case of EST's this read may be a unique representative of a particular gene (or a genomic sequence contaminant) that happens to contain an Alu repeat and thus happens to match other reads in the data set; or it may represent the only read of a particular alternatively spliced form; or it may have data anomalies of some sort (chimeras, etc.). Such a read would end up in a contig all of its own. 187) ARE THERE READS THAT ARE TOTALLY UNALIGNED? Unfortunately, yes. In my opinion, Phrap shouldn't have put them in the assembly at all. But we just have to live with it. You can find if a read is totally unaligned by pointing the the read name in the Aligned Reads Window and holding down the right mouse button. Consed will tell you the aligned positions, the high quality position, and the chemistry of the read. ---------------------------------------------------------------------------- WHAT IS AUTOFINISH? Autofinish automatically chooses reads for finishing. Autofinish sometimes is able to completely finish a project with no human decisions. In other cases Autofinish mostly finishes a project, and a human just needs to do the final difficult problems since all the routine problems have already been completed by Autofinish. Thus a human finisher is able to complete far more projects in the same length of time. Autofinish is flexible to the finishing strategy of your lab. It can be used to finish with just universal primer reads, just oligo walks, just minilibraries, or a combination of these. It can be used to finish either genomic or cDNA. Autofinish will do the following: -close gaps -improve sequence quality -determine the relative orientation of contigs -ensure that, at each consensus base, at least 2 reads from different templates are aligned (You can configure Autofinish to do any combination of these tasks.) Autofinish will suggest the following types of experiments: -universal primer reads (forward or reverse) -custom primer reads with subclone templates -custom primer reads with whole clone templates -minilibraries (transposon or shatter) from subclone templates -PCR (You can configure Autofinish to suggestion any combination of these experiments.) ------------------------------------------------------------------------ USING AUTOFINISH Note: Before you use Autofinish on your own data, you must modify determineReadTypes.perl. See INSTALLING CONSED above for information about this. To do the exercises in this section, it would help to be able to edit a file under UNIX and run a program under UNIX. If you can't do that, have someone teach you. (It will not work to edit a file on Windows and then transfer to UNIX.) Typical editors on UNIX are vi and emacs, but pico is probably the simplest for occasional users. You can find more information on pico from: http://www.strath.ac.uk/IT/Docs/IntroToUnix/node122.html You should also learn how to examine a file in UNIX, how to move around the filesystem, etc. If you don't know how to do this, consult: http://www.washington.edu/computing/unix/startdoc/files.html and http://www.washington.edu/computing/unix/startdoc/directories.html There are also many books about Unix at bookstores. 188) Type: cd autofinish/edit_dir (You might need to first type "cd ../.." depending on which directory you are currently in.) 189) Try starting Autofinish by typing: ../../consed -ace autofinish.fasta.screen.ace.1 -autofinish (Note 'consed' above may be 'consed_solaris', 'consed_solaris_intel', 'consed_solaris64', 'consed_alpha', 'consed_hp', 'consed_sgi', 'consed_ibm', 'consed_mac', 'consed_linux2.4', 'consed_linux2.6', 'consed_linux2.6_dyn', 'consed_linux_itanium', 'consed_amd64', or 'consed_amd64_dyn', depending on your executable. If you have trouble, use that 'ls' command (see above) or consult the person who installed Consed! ) If Autofinish says: Run-time exception error; current exception: InputDataError No handler for exception. Abort that means that you have not followed the instructions under 'INSTALLING CONSED' above. Please follow those instructions and then try this again. When you have successfully run the above command, Autofinish will create 7 files: autofinish.fof (project name).001014.155627.customPrimers (project name).001014.155627.nav (project name).001014.155627.out (project name).001014.155627.sorted (project name).001014.155627.univForwards (project name).001014.155627.univReverses Where '001014.155627' is replaced by your current date and time in format YYMMDD.HHMISS. The first file, autofinish.fof, is a file of filenames. It contains the names of the other files. (project name).001014.155627.univForwards is the summary file of the suggested universal forward subclone reads (project name).001014.155627.univReverses is the summary file of the suggested universal reverse subclone reads (project name).001014.155627.customPrimers is the summary file of the suggested custom primer reads These are the files you will typically use for directing your bench work. If you like, you can import these files into Excel since the fields are separated by commas. The .out file is the Autofinish output file. This is the most important file to examine while you are evaluating Autofinish. If you want to know *why* Autofinish picked the reads it did, it will tell you. Consult this file before you start complaining about Autofinish's choices. I've had people complain, and then, once they look in the .out file (*not* any of the other files), they learn information that persuades them that Autofinish was correct all along. This is hard to over-emphasize, but I will try to over-emphasize it: It will tell you lots more, such as the orientation of the contigs. It will also tell you the value of all Autofinish parameters used. If you try to customize one of the parameters, check in the .out file to be sure that Autofinish used the value you intended. CONSULT THE .out FILE CAREFULLY IF YOU DISAGREE WITH ANY OF AUTOFINISH'S CHOICES! The .sorted file gives the reads sorted by contig and position. This file is useful if you want to find what reads Autofinish suggested for a particular location. It is *not* useful for understanding *why* Consed chose a particular read. It is deliberately terse to make it useful for automation the ordering of reads. The .nav file is a custom navigation file (see "CUSTOM NAVIGATION" far below). This file allows a Consed user to just click 'next', 'next', ... to review all of Autofinish's suggestions in context. This is a great way to quickly and easily review all of the reads suggested by Autofinish. This finishing tool is designed to be run in batch after each assembly. In a high throughput operation, the production people can make these reads without anyone using Consed to examine the assembly interactively. Only when Autofinish cannot help you any longer (generally after 3 or more times of running Autofinish, making the reads, and re-assembling), must you bring up Consed graphically and examine the assembly. We suggest that you write some of your own software to parse the summary files to automatically order primers and reads. The summary files (.customPrimers, .univForwards, .univReverses) will not change much but the .out file may change, so don't try to parse it. AUTOFINISH: MINIMUM NUMBER OF ERRORS FIXED PER READ 190) By default, the minimum number of errors fixed by an experiment is 0.02 Human finishers typically look for low consensus quality regions--regions that have one or more bases below a particular quality threshold. However, Autofinish can do better: it can find regions where the *total* number of errors is greater than some particular cutoff value. This method can find regions where none of the bases are low quality, but many are medium quality and thus the total number of errors in the region is high. Autofinish will also ignore regions that have a very few low quality bases, as long as the total number of errors is smaller than your cutoff. This is a better critereon because it is the total number of errors that you are trying to reduce when finishing--not the number of bases with quality below some arbitrary cutoff. Two bases of quality 20 have 0.02 errors (on average). Similarly, 200 bases of quality 30 have 0.02 errors (on average). (Quality values were explained at the beginning of this document.) Suppose that you want Autofinish to suggest an additional read for an area that even just has one quality 20 base. (Be aware that Autofinish will consider 10 quality 30 bases to be just as severe as 1 quality 20 base since, on average, they will both have precisely the same number of errors: 0.01) 191) EDIT PARAMETERS: HOW TO CHANGE CONSED/AUTOFINISH PARAMETERS This shows how to change consed.autoFinishMinNumberOfErrorsFixedByAnExp. To change any other parameter, follow these same instructions replacing consed.autoFinishMinNumberOfErrorsFixedByAnExp with the parameter you want to change. In the edit_dir directory is a file called ".consedrc" which you will only see if you use "ls -a" instead of just "ls". In that .consedrc, add the following line: consed.autoFinishMinNumberOfErrorsFixedByAnExp: 0.01 You can do this using an editor, such as pico, or you can do it with Consed. To do it with Consed, bring up consed as follows: consed -ace autofinish.fasta.screen.ace.1 On the Consed Main Window, point to the "Options" menu, push down the left mouse button and release on "Edit Consed/Autofinish Parameters". Up will pop the "Edit Parameters" window. Near the top is "consed.autoFinishMinNumberOfErrorsFixedByAnExp". Point and click in the box on the left containing 0.02 just underneath "consed.autoFinishMinNumberOfErrorsFixedByAnExp". After clicking, the box outline should turn bold and the cursor should start blinking. Change the 0.02 to 0.01. Click on "just project" near the bottom of the window. The box containing 0.01 should turn red indicating that it is now different than the default. Then click "save". A box titled "Name of parameter file to write" should pop up. Click "ok". Note: you can changed more than one of these values before clicking "save". When using the Edit Parameters Window, I suggest that you do not click on the up and down arrows of the vertical scrollbar because these will scroll by too much. Instead, I suggest you point to the thumb of the vertical slider, hold down the left mouse button and drag the thumb. Alternatively, point to the black space above or below the thumb and click with the left mouse button. You need to try this to understand. To be sure that everything happened correctly, look at .consedrc file. It should contain the line: consed.autoFinishMinNumberOfErrorsFixedByAnExp: 0.01 (If you don't know how to view a file, get a UNIX book and learn the commands "less", "more", "pico", "vi", or "emacs".) (Get in the habit of checking .consedrc after using Consed's Edit Parameter Window.) AUTOFINISH: MINIMUM NUMBER OF ERRORS FIXED PER READ (continued) Then run Autofinish again: consed -ace autofinish.fasta.screen.ace.1 -autofinish Look at the files just created by typing 'ls -tlr' and look at the .out file by bringing it up with your favorite UNIX editor. You should see: PARAMETERS_CHANGED_FROM_DEFAULTS { . consed.autoFinishMinNumberOfErrorsFixedByAnExp: 0.010 . . Further down is a section: PARAMETERS { ! If you want to modify any of these parameters, just cut/paste ! the relevant line into your ~/.consedrc file ! (or into the edit_dir/.consedrc file) ! In the following, I have annotated the parameters with the following ! symbols: ! ! (YES) freely customize to your own site ! (OK) don't change unless you have a specific need and know what you ! are doing ! (NO) don't change this! This section contains all Autofinish parameters, whether you have changed them or not. Thus a changed parameter will be in both lists. Find consed.autoFinishMinNumberOfErrorsFixedByAnExp: 0.010 in this second list. Then compare the .sorted files from this run of Autofinish and the previous run of Autofinish in which the consed.autoFinishMinNumberOfErrorsFixedByAnExp value 0.02 You will notice that there are 2 additional reads suggested when the parameter is 0.01. There is a resequence with dye terminator chemistry of the djs228_474 template and a de novo reverse on template djs228_2632. Look at the .out file to see why Autofinish chose these reads. It will indicate that the first read is mainly to fix 0.01 errors in the region from 2536 to 2545 and the second read to mainly fix 0.01 errors from 969 to 978. Bring up Consed to see what is in the 10 base region from 2536 to 2545. You will see that there is a quality 25 base at 2539 and a quality 21 base at 2540. After that come some bases whose qualities are in the high 30s. In the Aligned Reads Window, point at the Misc menu, hold down the left mouse button, and release on Show Error for a Region. Enter 2539 and 2549 for the "Left Consensus Position of Region" and "Right Consensus Position of Region" respectively and click on "Calculate". You will see that there are .0135 errors in this region. This is less than 0.02 so Autofinish will not try to fix this region unless you reduce consed.autoFinishMinNumberOfErrorsFixedByAnExp to 0.01 The default is 0.02 because most labs do not want to fix regions that have less than 0.02 errors. 192) DIVERSION: UNIX LESSON Note for UNIX novices: Earlier, I said that you only needed to know 3 UNIX commands: pwd, ls, and cd. Then I added "ls -a", "less" and an editor (such as pico). Now I want you to learn one more: ls -tlr This is the same as ls, but it puts one file on a line and prints the lines so that the most recent files are on the bottom. Since you will be creating many, many files as you work through these Autofinish exercises, this command gives an easy way to see the files you have just created, without having to always look at autofinish.fof to look for the names of the files you just created. AUTOFINISH: CHANGING MELTING TEMPERATURES 193) Use 'ls -tlr' to find the most recent .out file. Search in the .out file (using your favorite editor) for MeltingTemp and you will find the following lines: consed.primersMinMeltingTemp: 55 consed.primersMaxMeltingTemp: 60 Some labs prefer to use primers with lower melting temperatures. In your .consedrc file, put the following lines: consed.primersMinMeltingTemp: 50 consed.primersMaxMeltingTemp: 55 You can do this by following the instructions above under HOW TO CHANGE CONSED/AUTOFINISH PARAMETERS. When you are done doing that, look in the .consedrc file to make sure it contains the above 2 lines. Then run Autofinish again: consed -ace autofinish.fasta.screen.ace.1 -autofinish Using your favorite editor, check that the .out file you just created says: consed.primersMinMeltingTemp: 50 consed.primersMaxMeltingTemp: 55 (You can find the most recent .out file by typing 'ls -tlr'.) Compare the .sorted files from this run of Autofinish and the previous run. The difference should be the custom primer read: The previous .sorted file had: tcttttgtctttccatatacatttt,56 which means the melting temperature is 56. The latest .sorted file had: cattttagaatcagtttgttg,50 which means the melting temperature is 50. 194) AUTOFINISH: JUST CLOSING GAPS You could use Autofinish to just close gaps (you are not interested in fixing single subclone regions or weak regions). Add the following to the .consedrc file (and remove everything else so that Autofinish uses the default values for everything else): consed.autoFinishCoverLowConsensusQualityRegions: false consed.autoFinishCoverSingleSubcloneRegions: false If you are using the Edit Parameter Window to change these values, you will find them when scrolling about 1/3 way down. Change the consed.primersMinMeltingTemp and consed.primersMaxMeltingTemp back to their original values. Then check the .consedrc to make sure it contains the above 2 lines. (Get in the habit of checking .consedrc after using Consed's Edit Parameter Window.) Now you should see in the .sorted file just 4 reads: one custom primer read pointing out the left end of the contig and 3 reverses off the left end of the contig. The right end is not extended because Autofinish recognizes that it is the end of the BAC. You can change any of the parameters listed at the top of the Autofinish output file (or actually any of the more exhaustive list of parameters listed in the 'Info' menu, 'Show Consed Parameters' list.) We believe the defaults are an excellent starting point. 195) AUTOFINISH: JUST CLOSING GAPS JUST USING WALKS One high-throughput operation was only interested in closing gaps and only interested in using walks to close those gaps. This is the appropriate set of Autofinish parameters to do this: consed.autoFinishCoverSingleSubcloneRegions: false consed.autoFinishCoverLowConsensusQualityRegions: false consed.autoFinishAllowDeNovoUniversalPrimerSubcloneReads: false consed.autoFinishAllowPCR: false consed.autoFinishAllowResequencingReads: false consed.autoFinishAllowMinilibraries: false consed.autoFinishNearGapsSuggestEachMissingReadOfReadPairs: false consed.autoFinishCallReversesToFlankGaps: false (and every other parameter left the default value). The first 2 parameters are the same as the "AUTOFINISH: JUST CLOSING GAPS" section (above). The other parameters tell Autofinish all of the types of reactions it is not allowed to use, leaving just walks. Try this. Now you should see only a single read, a walk, pointing left off the left end of the contig. 196) AUTOFINISH: NOT REPEATING FAILED EXPERIMENTS For this exercise, keep a backup copy of the ace file: cp autofinish.fasta.screen.ace.1 autofinish.fasta.screen.ace.1.save If you run Autofinish with the -doExperiments parameter (see below), -doExperiments causes Autofinish to record its suggestions in the ace file (hence changing the ace file). If one of these suggested reads fails to fix a problem, when Autofinish is run again it won't pick the same read again. consed -ace (ace file name) -autofinish -doExperiments If a forward or reverse universal primer read failed, Autofinish (when run in a subsequent round) will not suggest that same experiment. If a custom primer read fails, Autofinish will not pick that same experiment again, and it won't pick a custom primer read that is even close to the failed one. 'Close' is defined by the parameter: consed.autoFinishNewCustomPrimerReadThisFarFromOldCustomPrimerRead: 50 In addition, Autofinish (the next time it is run) will tell you how well each experiment did in solving the problem it was intended to solve. Return the parameters to the defaults and try this by running Autofinish twice like this: consed -ace autofinish.fasta.screen.ace.1 -autofinish -doExperiments consed -ace autofinish.fasta.screen.ace.1 -autofinish -doExperiments and look at the .out file from the 2nd run. (You can find the most recent .out file by typing 'ls -tlr'.) You should see lines such as this: rejecting experiment: reverse universal primer read with template djs228_1094 because an earlier round of autofinish called this with expid: 1 rejecting experiment: reverse universal primer read with template djs228_1422 because an earlier round of autofinish called this with expid: 2 rejecting experiment: reverse universal primer read with template djs228_1034 because an earlier round of autofinish called this with expid: 3 This is Autofinish trying experiment after experiment but finding they were already suggested in an earlier round of Autofinish. You should not type '-doExperiments' if you do not intend to do the experiments Autofinish suggests. If you use -doExperiments, but you don't really do the experiments, and then you run Autofinish again, Autofinish will be very upset--it will think that all of its suggested experiments failed (because it can't find them). It will see that all of the problems are still present but it will think that it should not choose any of those same experiments again so it will suggest different experiments that will not be as good as its original suggestions. -doExperiments will also cause suggested oligos to be tagged. Primer id's created by Autofinish use the same naming scheme as primers created in Consed and they will not conflict with each other. For example, if Autofinish creates oligos djs14.1, djs14.2, and djs14.3, then the next primer that a user accepts will be djs14.4. If Autofinish is run a second time, it will start with primer djs14.5. When you have completed this exercise with -doExperiments, replace the original .ace file by typing: cp autofinish.fasta.screen.ace.1.save autofinish.fasta.screen.ace.1 197) AUTOFINISH: doNotFinish particular regions If there is a region that you don't care to finish (e.g., it has already been finished by an overlapping clone or you know there is no gene there), then you can put a doNotFinish tag on the consensus and Autofinish will not try to finish this area. First, delete the .consedrc file (or, if you are using the Edit Parameter Window of Consed, restore the parameters to their default values) and run Autofinish again: consed -ace autofinish.fasta.screen.ace.1 -autofinish Bring up consed: consed -ace autofinish.fasta.screen.ace.1 and put a doNotFinish tag on the region from 2000 to 4000. (If you don't know how to do that, read through the Consed Quick Tour, above.) Save the assembly as autofinish.fasta.screen.ace.2 Run Autofinish again: consed -ace autofinish.fasta.screen.ace.2 -autofinish Look at the .out files for each of the 2 runs of Autofinish. (You can find the most recent .out files by typing 'ls -tlr'.) You will notice in the .out file for the 2nd run of Autofinish that, in the other than the experiments to extend the contig to the left, there is only one experiment which is from 315 to 1662. If you find that experiment in the .out file, it will say "Contig1 0.05 errors fixed in region from 315 to 1662 fixing 0.05 errors from 969 to 978" The "969 to 978" gives the worst 10 base window that the read is intended to fix. If you look with Consed, you will see that there is a quality 12 base at 974. You can also use doNotFinish tags to prevent Autofinish from *extending* a contig into a gap by putting a doNotFinish tag near the end of the contig and setting the following Autofinish parameters: consed.autoFinishDoNotExtendContigsWhereTheseTagsAre: doNotFinish consed.autoFinishDoNotExtendContigsIfTagsAreThisCloseToContigEnd: 50 198) AUTOFINISH: NOT USING PARTICULAR SUBCLONE TEMPLATES If you no longer have a template that was used in shotgun, and thus you don't want Autofinish to pick that template, you can put it in a file badTemplates.txt in edit_dir. This is a simple file with one name per line. Using your favorite UNIX editor, create a file called "badTemplates.txt" in edit_dir. Make it contain a single line: djs228_1094 Delete .consedrc (or, if you are using the Edit Parameter Window, restore the parameters to their defaults) and run autofinish again: consed -ace autofinish.fasta.screen.ace.1 -autofinish Search the .out file for djs228_1094. You will find one line like this: not using template: djs228_1094 because in bad templates file Now try deleting badTemplates.txt and running autofinish again the same way. You will notice there are many differences in reads chosen, since djs22_1094 is now available again for making reverses as well as a template for custom primer walks. badTemplates.txt can accept "*" (match any characters) as part of the name. For example, djs140_23* will eliminate templates: djs140_235684 djs140_235783 djs140_2326 etc. 199) AUTOFINISH: NOT USING ENTIRE LIBRARIES FOR FINISHING In addition to the badTemplates.txt file, you can use a badLibraries.txt file which contains a list of all libraries that are off-limits to Autofinish (e.g., you threw away all subclone templates from this library or they are from a different lab which gave you the chromatograms but not the templates). Autofinish determines the library of a read by the following in the PHD file: WR{ template dscript 990603:090231 name: djs366_101 lib: library1 } where "library1" is replaced by the actual library name. Take a look at any phd file in autofinish/phd_dir and you will see this. Generally, determineReadTypes.perl puts this library information into the PHD file. Make sure that badTemplates.txt is deleted and .consedrc is either deleted (or use the Edit Parameter Window to restore the defaults) and run Autofinish again. consed -ace autofinish.fasta.screen.ace.1 -autofinish Now create a file badLibraries.txt containing a single line: lib1 and run autofinish again: consed -ace autofinish.fasta.screen.ace.1 -autofinish Look at the .out file. You will see lines like this: not using template: djs228_1034 because in bad libraries file not using template: djs228_1051 because in bad libraries file not using template: djs228_1094 because in bad libraries file . . . You will see that there are no reads suggested that use any of these templates, even though some of them (e.g.., djs228_1034) were used in the Autofinish run (above) before you created the badLibraries.txt file. When you start doing this with your own data, you must put the lib: line into your phd files. Do this by modifying determineReadTypes.perl. 200) MULTIPLE LIBRARIES WITH DIFFERENT INSERT SIZES If different libraries have different insert sizes, Autofinish must know the insert size of each library. If there are 5 or more forward-reverse pairs, where the forward and reverse are both in the same contig, then Consed/Autofinish calculates the insert size of the library by finding the mean and standard deviation of the insert sizes of these forward-reverse pairs. The maximum insert size of the library is set at the mean plus 2.5 times the standard deviation. If there are fewer than 5 forward-reverse pairs, where the forward and reverse are both in the same contig, Consed/Autofinish considers this statistical information unreliable so instead relies on a file called 'librariesInfo.txt" which must be placed in edit_dir (where the ace file is). This file looks like this: LIB{ name: lib0 avgInsertSize: 1500 maxInsertSize: 3000 stranded: double cost: 600.0 } LIB{ name: lib1 avgInsertSize: 3000 maxInsertSize: 5000 stranded: double cost: 1000.0 } LIB{ name: lib2 avgInsertSize: 10000 maxInsertSize: 12000 stranded: double cost: 5000.0 } 'name' is the name of the library. This is the name that goes into the PHD file after the 'lib:' keyword (see AUTOFINISH: NOT USING ENTIRE LIBRARIES FOR FINISHING above). 'avgInsertSize' is the average insert size of the library--the figure to be used by Autofinish if there are not enough forward/reverse pairs for Autofinish to calculate the mean insert size of the library. 'maxInsertSize' is the maximum insert size--if forward/reverse pairs are further apart than this, Autofinish will assume these reads are misassembled. 'stranded' is whether this template is single or double stranded. 'cost' is the cost of making a minilibrary out of a template from this library. In .consedrc, there must be a line like this: consed.primersMaxInsertSizeOfASubclone: 5000 where 5000 is replaced by whatever the maximum insert size of all of your different libraries. For this exercise make .consedrc have a single line: consed.primersMaxInsertSizeOfASubclone: 12000 Alternatively, use the Edit Parameter Window to set consed.primersMaxInsertSizeOfASubclone to 12000. For this exercise I have a file in edit_dir called "librariesInfo.txt_hide". To make Autofinish pay attention to it, do the following: cp librariesInfo.txt_hide librariesInfo.txt Delete badLibraries.txt: rm badLibraries.txt Before you run Autofinish again, first restart Consed: consed -ace autofinish.fasta.screen.ace.1 On Consed's Main Window, point to 'Info', hold down the left mouse button, and release on 'Show Library Info'. You should see the names of your libraries and the correct number of reads in each library. This feature will be useful in debugging your use of librariesInfo.txt Then run Autofinish again: consed -ace autofinish.fasta.screen.ace.1 -autofinish Look at the .out file. Look for the following: "Choosing de novo universal primer reads to try to close gaps" You will see there are many reads under this heading. These are the lib1 and lib2 reads that have a large average insert size and thus span the gap. Autofinish did not choose some of these reads before because, if the insert size were only 1500 bases, these reads would not have helped to close the gap. When you are done with this exercise, delete librariesInfo.txt and .consedrc When there are many reads from the same library, Consed/Autofinish will look at the forward/reverse pairs that are within the same contig (so the insert size of that template can be directly measured) and figure out the mean and standard deviation of the insert size of templates from that library. Consed/Autofinish will use these numbers rather than the number from librariesInfo.txt 201) AUTOFINISH CLOSING GAPS WITH MINILIBRARIES If you wanted Autofinish to *only* suggest minilibraries to close gaps, use the following parameters: consed.autoFinishAllowWholeCloneReads: false consed.autoFinishAllowCustomPrimerSubcloneReads: false consed.autoFinishAllowResequencingReads: false consed.autoFinishAllowDeNovoUniversalPrimerSubcloneReads: false consed.autoFinishAllowPCR: false consed.autoFinishAllowResequencingAUniversalPrimerAutofinishRead: false consed.autoFinishCallReversesToFlankGaps: false consed.autoFinishAllowMinilibraries: true consed.autoFinishAlwaysCloseGapsUsingMinilibraries: true consed.autoFinishPrintMinilibrariesSummaryFile: true For this exercise, type: cd assembly_view/edit_dir (You might need to first type "cd ../.." depending on which directory you are currently in.) Attention! This is *not* the same directory you have been using. It, autofinish/edit_dir, does not have any gaps so it cannot be used for this exercise. Create a .consedrc file with the parameters above in it. Alternatively, start Consed in this directory and use the Edit Parameter Window to modify the parameters as above. Then run Autofinish: consed -ace assembly_view.fasta.screen.ace.1 -autofinish When it has completed, look in the .out file. You will see the following: Enough existing fwd/rev pairs to establish: Left end of Contig3 has 13 fwd/rev pairs connecting it to Right end of Contig2 with gap size -460 (contigs overlap) Trying to suggest minilibrary for gap between right end of Contig2 and left end of Contig3 MINILIBRARY{ best template: djs736a2_fp04q274 from lib djs736a2 size: 3607 errors fixed: 0.01 errors fixed per dollar: 0.00 connecting right end of Contig2 to left end of Contig3 with estimated gap size -460 alternative template: djs736a1_fp02q472 from lib djs736a1 size: 1184 errors fixed: 0.01 errors fixed per dollar: 0.00 } You will also see a more terse (but more easily parseable) description in the .minilibraries file. The parameter: consed.autoFinishPrintMinilibrariesSummaryFile: true will cause Autofinish to print a file with name similar to: (project name).001014.155627.minilibraries Or you could be more sparing in which gaps you close with minilibraries and which you do not: consed.autoFinishAlwaysCloseGapsUsingMinilibraries: false If the parameter above is set to false, then Autofinish will only choose minilibraries if the gap is the size below or larger: consed.autoFinishSuggestMinilibraryIfGapThisManyBasesOrLarger: 800 If you try this in this example, you will see that Autofinish will not suggest a minilibrary because the gap has negative size (meaning the contigs overlap) and thus is not more than 800 bases. Autofinish can suggest more than one minilibrary per gap: consed.autoFinishSuggestThisManyMinilibrariesPerGap: 2 is the default, but you can increase it. If you try this, you will see more alternate templates suggested for the minilibrary. When you are done, delete the .consedrc file. 202) CLOSING GAPS USING PCR If you are interested in just closing remaining gaps with PCR, you can set the following Autofinish parameters: consed.autoFinishAllowWholeCloneReads: false consed.autoFinishAllowCustomPrimerSubcloneReads: false consed.autoFinishAllowResequencingReads: false consed.autoFinishAllowDeNovoUniversalPrimerSubcloneReads: false consed.autoFinishAllowMinilibraries: false consed.autoFinishAllowPCR: true consed.autoFinishAllowResequencingAUniversalPrimerAutofinishRead: false consed.autoFinishCallReversesToFlankGaps: false consed.autoFinishCoverLowConsensusQualityRegions: false consed.autoFinishCoverSingleSubcloneRegions: false consed.autoFinishNearGapsSuggestEachMissingReadOfReadPairs: false This will cause Autofinish to try to close all gaps using PCR. Type: cd assembly_view/edit_dir (You might need to first type "cd ../.." depending on which directory you are currently in.) (This is because the autofinish/edit_dir project does not have any gaps.) Create a .consedrc file with the parameters above in it. Then run Autofinish: consed -ace assembly_view.fasta.screen.ace.1 -autofinish When it has completed, look in the .out file. You will see the following: 436 acceptable primers on left end of contig Contig1 503 acceptable primers on right end of contig Contig1 520 acceptable primers on left end of contig Contig2 202 acceptable primers on right end of contig Contig2 523 acceptable primers on left end of contig Contig3 377 acceptable primers on right end of contig Contig3 Please make the following PCR primers: ttctgggtctggaggaca 485 to 502 (bottom strand) for left end of Contig1 melt: 57.5 taattgggactataggtacatgc 13202 to 13224 (top strand) for right end of Contig1 melt: 55.1 tttgttttgttttgtattttgttt 504 to 527 (bottom strand) for left end of Contig2 melt: 55.1 ctgttctcctgtcattctgg 9950 to 9969 (top strand) for right end of Contig2 melt : 55.7 gggcaagagctgtaaagag 114 to 132 (bottom strand) for left end of Contig3 melt: 55.3 accaaataacaggtaaaccaaa 15503 to 15524 (top strand) for right end of Contig3 melt: 55.4 Do PCR reactions with the following pairs of primers: ttctgggtctggaggaca tttgttttgttttgtattttgttt ttctgggtctggaggaca ctgttctcctgtcattctgg ttctgggtctggaggaca gggcaagagctgtaaagag ttctgggtctggaggaca accaaataacaggtaaaccaaa taattgggactataggtacatgc tttgttttgttttgtattttgttt taattgggactataggtacatgc ctgttctcctgtcattctgg taattgggactataggtacatgc gggcaagagctgtaaagag taattgggactataggtacatgc accaaataacaggtaaaccaaa tttgttttgttttgtattttgttt gggcaagagctgtaaagag tttgttttgttttgtattttgttt accaaataacaggtaaaccaaa ctgttctcctgtcattctgg gggcaagagctgtaaagag ctgttctcctgtcattctgg accaaataacaggtaaaccaaa printing experiment summary files: assembly_view.020320.130220.univForwards assembly_view.020320.130220.univReverses assembly_view.020320.130220.customPrimers assembly_view.020320.130220.sorted The first is the list of PCR primers to synthesize. The second list gives which pairs of the primers in the first list to do PCR with. (It doesn't make sense to do PCR with the primer off the left end of Contig2 and the primer off the right end of Contig2.) Some of these pairs of PCR primers will give products and others will not (or will give enormous products). The ones giving products will tell you how the contigs are ordered and oriented. You can then sequence the product to find the gap sequence between the contigs. 203) AUTOFINISH: TOO MANY UNIVERSAL PRIMER READS St Louis wanted more universal primer reads, so I put in a feature that allows for redundant universal primer reads. If you get too many for your taste, then put this into your .consedrc file: consed.autoFinishRedundancy: 1.0 The default is 2.0, meaning that Autofinish will try to fix every problem area twice--once by some universal primer reads and once again by other universal primer reads. Then, and only then, will it try oligo walks to finish remaining problems. Baylor wanted more reverses to close gaps, so I put a feature into Autofinish that calls *all* reverses near gaps: (contig) ___________________________ <- reverse 1 <- reverse 2 <- reverse 3 <- reverse 4 (including reverses that are likely to fall into the gap) in the hope that enough of them will hook onto each other that the gap will be closed. (If there is already a reverse pointing out but no forward, Autofinish will suggest the forward.) If this feature gives you too many reverses for your taste, then in your .consedrc file: consed.autoFinishNearGapsSuggestEachMissingReadOfReadPairs: false 204) AUTOFINISH FOR CDNA ASSEMBLIES The way to use Autofinish for cDNA assemblies is to pretend that the cDNA is a BAC and that you are only going to allow whole clone custom primer BAC reads. To do this, put the following into your .consedrc file: consed.autoFinishAllowResequencingReads: false consed.autoFinishAllowWholeCloneReads: true consed.autoFinishAllowCustomPrimerSubcloneReads: false consed.autoFinishAllowDeNovoUniversalPrimerSubcloneReads: false consed.autoFinishAllowPCR: false consed.autoFinishCDNANotGenomic: true consed.autoFinishCheckThatReadsFromTheSameTemplateAreConsistent: false consed.checkIfTooManyWalks: true consed.autoFinishExcludeContigIfOnlyThisManyReadsOrLess: 0 consed.autoFinishExcludeContigIfDepthOfCoverageOutOfLine: false consed.autoFinishExcludeContigIfThisManyBasesOrLess: 0 consed.autoFinishCoverSingleSubcloneRegions: false consed.autoFinishContinueEvenThoughReadInfoDoesNotMakeSense: true consed.autoFinishCallReversesToFlankGaps: false You don't want Autofinish to try to extend off the 3' end or the 5' end of the cDNA, right? How is Autofinish going to determine that? It determines it as follows: In the 5' end read, put the following into the phd file: WR{ primer determineReadTypes 001019:112654 type: univ fwd } WR{ template determineReadTypes 001019:112654 name: cDNA1 } In the 3' end read (the read that is primed off the polyA tail), put the following into the phd file: WR{ primer determineReadTypes 001019:112654 type: univ rev } WR{ template determineReadTypes 001019:112654 name: cDNA1 } For all other reads, such as transposon reads and custom primer walks, put the following into the phd file: WR{ primer dscript 001019:112654 type: walk } WR{ template determineReadTypes 001019:112654 name: cDNA2 type: bac } If you are going to finish many cDNA's, you will find it will work better to modify determineReadTypes.perl than to go editing every phd file. So Autofinish finds the univ fwd read and assumes it indicates the 5' end of the cDNA and it finds the univ rev read and assumes it indicates the 3' end of the cDNA. (The parameter consed.autoFinishCDNANotGenomic: true tells it to try to find the end of the cDNA in this manner.) There is one additional problem when using Autofinish for cDNA assemblies: initially, the ace file created by phrap is empty since the 3' and 5' reads don't overlap enough. You have *no* contigs for Autofinish to finish. So phrap is of no use initially. But you can use Consed to create the assembly: First run phredPhrap to phred both reads and run determineReadTypes.perl Then pick the 3' read and run phd2Ace.perl on it: phd2Ace.perl (name of phd file) This will give you an ace file with one read in it. Now suppose that you have other reads from the same cDNA. You can use this technique to add them to the ace file: To add all the reads phrap has neglected to put into the ace file, do the following: 1. create a file of read names. E.g., djs74_1180.s1 djs74_1432.s1 djs74_1455.s1 djs74_1465.s1 djs74_1532.s1 djs74_1802.s1 djs74_1803.s1 Typically, you will get this list of reads by looking in the singlets file. Then run consed: 2. consed -ace old_ace.ace -addNewReads fileOfReadNames.txt -newAceFilename new_ace.ace where: fileOfReadNames.txt is the name of the file (above) containing the read names new_ace.ace is whatever you want the new ace file to be named old_ace.ace is the name of the old ace file Now you have an ace file that contains all the reads you have sequenced for that cDNA. You can now run Autofinish on it: consed -ace new_ace.ace -autofinish 205) AUTOFINISH FOR LISTING GAP-SPANNING TEMPLATES Sometimes people ask me for how to make Autofinish suggest all templates that span a gap. People who ask this question are not using Autofinish to automate finishing--they are using it as a tool in the hand of a human finisher. Although evidence has shown that Autofinish is far more powerful in an automated mode, it is also a powerful tool in the hands of a human finisher. I will specify how to do this, but hope you will move to the next level of using it in an automated manner. One method is to just shut off Autofinish suggesting any experiments at all: consed.autoFinishCallReversesToFlankGaps: false consed.autoFinishAllowDeNovoUniversalPrimerSubcloneReads: false consed.autoFinishAllowResequencingReads: false consed.autoFinishCoverSingleSubcloneRegions: false consed.autoFinishCoverLowConsensusQualityRegions: false consed.autoFinishNearGapsSuggestEachMissingReadOfReadPairs: false consed.autoFinishAllowCustomPrimerSubcloneReads: false consed.autoFinishAllowPCR: false consed.autoFinishAllowMinilibraries: false Thus Autofinish will order and orient the contigs, printing out the forward/reverse pairs that connect the contigs, as exemplified below: Examining existing fwd/rev pairs that flank gap at Right end of Contig46 read (start end) mate read mate contig (start end) contig (pos pos) name name (pos pos) length agroa3_fp19q452.x1u3 -> -13 824 agroa3_fp19q452.y1 Contig47 -> 365 1282 1844 mag3gpk041f9.y1 -> 29 689 mag3gpk041f9.x1 Contig53 -> 139675 140402 140921 agroa3_fp06q173.x1u3_m -> 91 1053 agroa3_fp06q173.y1 Contig53 -> 139683 140618 140921 mag2gpk013f21.y1 -> 314 887 mag2gpk013f21.x1 Contig57 -> 257472 258018 261664 mag3gpk064f6.x1 -> 542 1173 mag3gpk064f6.y1 Contig53 -> 139061 139709 140921 mag3gpk105a18.y1 -> 710 1318 mag3gpk105a18.x1 Contig53 -> 138774 139329 140921 Enough existing fwd/rev pairs to establish: Right end of Contig53 has 4 fwd/rev pairs connecting it to Right end of Contig46 with gap size -17 (contigs overlap) This shows you that (according to the naming convention of this lab), the following templates span the gap between the right end of Contig53 and the right end of Contig46 (clearly one of these contigs is complemented with respect to the other): agroa3_fp19q452 mag3gpk041f9 agroa3_fp06q173 mag2gpk013f21 mag3gpk064f6 mag3gpk105a18 However, what are you going to do now with these templates? Walk on them? Resequence the universal primer reads? Whichever you plan to do, why not allow Autofinish to make the suggestions and spend you time on the harder problems? 206) FINISHING A SPECIFIC CONTIG ../../consed -ace autofinish.fasta.screen.ace.1 -autofinish -contig Contig1 This will just finish Contig1. 207) MARKING THE END OF THE CLONE Autofinish tries it best to recognize the end of the clone (BAC), and it does pretty well, but you might have information it doesn't have, such as knowing the sequence of the BAC vector or having reads that were primed from within the BAC vector. You can tell Autofinish this information by adding cloneEnd tags. You can do this in Consed as follow: In the Aligned Reads Window put the cursor on the consensus at the base position marking the end of the insert. Point at the "Misc" menu, hold down the left mouse button and release on "Add Clone End Tag With Insert To Right" (alternatively, "Add Clone End Tag With Insert To Left"). Then save the assembly and run Autofinish. If you want such tags to be added automatically, you could write a perl script to append such tags to the ace file. Some sites have found that this is not enough--they want to change all bases beyond the clone end tag to X's. You can do this either interactively or automatically. To do it interactively, in the Aligned Reads Window, put the cursor on the vector base at the vector/insert junction. Hold down the left mouse button on the 'Misc' menu and release the button on either 'Change to X's to Left in All Reads' or 'Change to X's to Right in All Reads'. However, if you are using Autofinish, you will probably also want to have this process automated. To do this, set the following parameter in .consedrc: consed.autoEditConvertCloneEndBasesToXs: true (It is set this way by default, so you normally won't need to do this unless you have unset it.) Then run AutoEdit as follows: consed -ace (name of ace file with the clone end tags) -autoEdit This will create another ace file with a version number one higher than the one you just ran. If you want to specify a particular new ace file name, you can do it this way: consed -ace (old ace file) -autoEdit -newAceFileName (new ace file) After following this procedure, the consensus may start with X's and end with X's like this: XXXXXXXBBBBBBBBBBBBBBBBBBBBBBBXXXXXXXX ^ position 1 If you would rather that the consensus not contain this masked vector, but rather start with base position 1 being the first base of the insert like this below, you must reassemble with phrap. BBBBBBBBBBBBBBBBBBBBBBB ^ position 1 ---------------------------------------------------------------------------- USING AUTOMATED ADD NEW READS If you are sequencing the same region over and over and you have a reference sequence, phrap may not be a good choice for creating an assembly: phrap will take a long time to run (since many reads match each other), phrap may make several contigs when you know there should be only one, and phrap may not put all the reads into the assembly. Consed provides an alternative to phrap. Use it as follows: If the reference sequence is in fasta format, first follow the instructions below under ADDING READS WITHOUT CHROMATOGRAM FILES to create a phd file for the reference sequence. Make sure the phd file is in directory phd_dir. Then from the edit_dir directory, run phd2Ace.perl (name of phd file) This will create an ace file for an assembly that just contains the single reference sequence. Run consed to view it and make sure you have followed each of these steps successfully so far. Now we will align the reads to this reference sequence. Here is how to do it: 208) cd to the standard/edit_dir directory, as in the beginning of the QUICK TOUR. 209) Follow the instructions under "ADD NEW READS" above including cp ../chromats_to_add/* ../chromat_dir 210) Looks at the file "reads_to_add.fof" which contains a list of the reads to be added. 211) Run: consed -ace standard.fasta.screen.ace.1 -addNewReads reads_to_add.fof -newAceFilename standard.fasta.screen.ace.20 When this completes, there will be a new ace file standard.fasta.screen.ace.20 with all the reads added. There will also be a custom navigation file that is named something like: standard.070913.141632.nav where 070913.141632 is the date and time so will be different for you. (See CUSTOM NAVIGATION below.) This will allow you to visually find each added read in the assembly, if you so choose. What Consed does is take each reads and try to align it against the reference sequence. It will thus attempt to make one contig with all of the reads in it. Some reads may not align very well against the reference sequence. In that case, you can tell consed what you want to do by the following parameter in the .consedrc file: consed.addNewReadsPutReadIntoItsOwnContig: ifUnaligned means that if a read does not match the reference sequence very well, it will be put into its own contig. (For information on how to change the .consedrc file, see EDIT PARAMETERS: HOW TO CHANGE CONSED/AUTOFINISH PARAMETERS elsewhere in this document.) consed.addNewReadsPutReadIntoItsOwnContig: never means that if a read does not match the reference sequence very well, it will not be put into the assembly at all. consed.addNewReadsPutReadIntoItsOwnContig: always means that each read is not even compared to the reference sequence, but just put into its own contig. Consed also will typically recalculate the consensus quality values, unless you specify in your .consedrc file: consed.addNewReadsRecalculateConsensusQuality: false ---------------------------------------------------------------------------- USING AUTOPCRAMPLIFY If you have a fasta sequence, and you want to amplify part of that sequence using pcr, and you want to select a pair of PCR primers, you can do that using Consed's autoPCRAmplify function. It can handle very high throughput: on a slow computer it takes about 5 minutes to find PCR primers for a hundred different regions. If the middle region of the sequence is unknown, you can put N's. If you don't know how many N's, put any number--it doesn't matter. For example: 212) For this exercise, create an empty directory and make a fasta file in it called "brian.fasta" with the following contents: >AP000527.C22.6.mRNA.primerRegion 1 70 81 150 smallest ACAGGGCCCCTCGCGGGCCCTGACGCAGGATGGAGTTGAGGTGGGGGCAG CGCTGGACCCCAGGGCCCCTNNNNNNNNNNTGCCGCAGTCTTGGATGATG GGTTCCTAGAAGCTCTCAACATCTCTTCTTAATTGGAGAAAGTGTTAAGC >AC004019.C22.4.mRNA.primerRegion 1 70 81 150 smallest AGCTGTGAGCTGTGCAATCATGTAACTAACTTTGTTTAAGTATTGTTTAG TCTTTCTGGTCTCCAGATGANNNNNNNNNNTCAGACATTCCACAGCTACC TAGAGGACATCATCAACTACCGCTGGGAGCTCGAAGAAGGGAAGCCCAAC The numbers 1 70 81 150 means that the left primer should be selected from the region from 1 to 70 of the sequence (starting at 1), so the primer should be chosen from the sequence: ACAGGGCCCCTCGCGGGCCCTGACGCAGGATGGAGTTGAGGTGGGGGCAG CGCTGGACCCCAGGGCCCCT The 81 150 means that the right primer should be selected from the region from 81 to 150 of the sequence, i.e. from within: TGCCGCAGTCTTGGATGATG GGTTCCTAGAAGCTCTCAACATCTCTTCTTAATTGGAGAAAGTGTTAAGC "smallest": -------------------- ------------------------- ---> <--- "biggest": -------------------- ------------------------- ---> <--- The word "smallest" means that the primers should be chosen so that the product is as small as possible. That means that the left primer should be chosen as far as possible to the right within the 1-70 region and the right primer should be chosen as far as possible to the left within the 81-150 region. If we had instead put "biggest", the primers would instead have been chosen to make the PCR product as large as possible. Notice that in the diagram above, I didn't make it look like this: "smallest": -------------------- ------------------------- ---> <--- (the primers are at the very edge of the regions). The reason is that in general, due to other checks on the primers, the primers that would make the absolute smallest product are not acceptable, and the primers must be backed up. Similarly for "biggest". 213) Then run the following: amplifyTranscripts.perl brian.fasta (The name comes from the fact that this perl program was originally developed to amplify cDNA transcripts.) You should see about 5 pages of output flash by the screen, ending with: Checking pairs ... Done Total space allocated: 0.504 Mbytes; currently free: 0.163 Mbytes in 4 blocks Total space allocated: 0.504 Mbytes; currently free: 0.163 Mbytes in 4 blocks Total # pairs: 1000, size: 0.044 Mbytes Total # segment blocks: 1, size: 0.060 Mbytes Total # diffs: 4, in 2 lists, size: 0.000 Mbytes (This is cross_match output.) 214) Look at the files just created in your directory. In particular, look at for_colleen_unsorted.txt which should look like this: PRIMER_PAIR { Region: AP000527.C22.6.mRNA.primerRegion Product size: 67 AP000527.C22.6.mRNA.primerRegionf: AGTTGAGGTGGGGGCAGC temp: 64 AP000527.C22.6.mRNA.primerRegionr: CATCATCCAAGACTGCGGC temp: 63 } PRIMER_PAIR { Region: AC004019.C22.4.mRNA.primerRegion Product size: 59 AC004019.C22.4.mRNA.primerRegionf: TTTAGTCTTTCTGGTCTCCAGATGA temp: 61 AC004019.C22.4.mRNA.primerRegionr: TCTAGGTAGCTGTGGAATGTCTGA temp: 60 } This gives the primers. The top strand primer is the one ending in 'f' and the bottom strand primer is the one ending in 'r'. Both are in 5' to 3' orientation, so the 'r' primer is reverse complemented from the sequence in the original fasta file. 215) To put these primers into 96 well format for ordering, type orderPrimerPairs.perl no The output will be: to_order.txt (the file in 96 well format) primersYYMMDD.fasta (a fasta file of the primers) for_colleen_sorted.txt (a file in the same format as for_colleen_unsorted.txt, but sorted by product length) 216) Alternatively, autoPCRAmplify can be used directly without the amplifyTranscripts.perl script, but this is a little harder. I suggest skipping this step unless amplifyTranscripts.perl is not meeting your needs. In this case, you must have an ace file readable by Consed. AutoPCRAmplify requires a file from you that specifies the regions you want to amplify: Here is an example of how to do this: cd autofinish/edit_dir (You might need to first type "cd ../.." depending on which directory you are currently in.) ls more autoPCRAmplify.txt You will see such a file: regionA Contig1 20-100 -> Contig1 1000-1160 <- biggest regionB Contig1 5200-5270 -> Contig1 6000-6050 <- smallest regionA and regionB are the identifiers for the 2 regions that will be amplified. "Contig1 20-100 ->" says that you want a top strand primer to be within the region 20-100 of Contig1. "Contig1 1000-1160 <-" says you want the bottom strand primer within the region 1000 to 1160 of Contig1. "biggest" means that if there are more than one pair of primers that satisfy the above conditions (there will typically be zillions), you want the one with that gives the largest product. "smallest" means you want the smallest product. Run autoPCRAmplify by typing: consed -ace autofinish.fasta.screen.ace.1 -autoPCRAmplify autoPCRAmplify.txt Type: ls -tlr to see what file was just created. It should be a file called autofinish.020301.113327.out (where 020301.113327 is replace by the current date/time in the format YYMMDD.HHMISS) Look at this file with your favorite UNIX editor and you will see the following (with lots of interspersed information): PRIMER_PAIR { id: regionA product_size: 1136 tgatttaatataatttcaagaaaatcc temp: 56 24-50 in Contig1 cattgtggttttaatttgcatt temp: 57 1138-1159 in Contig1 } PRIMER_PAIR { id: regionB product_size: 791 ggctgacgcttgtaatcc temp: 57 5249-5266 in Contig1 gattatacgcgtgagcca temp: 56 6022-6039 in Contig1 } These are the primer pairs for the 2 regions. ---------------------------------------------------------------------------- USING AUTOEDIT Autoedit is a program that will read an ace file, make edits, and then write out a new ace file, all without any interaction from the user. Thus Autoedit can be run automatically at night, the same way you can run phredPhrap. Autoedit has various options that are controlled from the .consedrc file the same as the .consedrc file controls Autofinish. Run AutoEdit as follows: consed -ace (name of exising ace file) -autoEdit This will create another ace file with a version number one higher than the one you just ran. If you want to specify a particular new ace file name, you can do it this way: consed -ace (old ace file) -autoEdit -newAceFileName (new ace file) Autoedit has the following options: consed.autoEditConvertCloneEndBasesToXs: true bool ! If true, will convert to X's bases of all reads that protrude beyond a ! cloneEnd tag. ! (YES) consed.autoEditTellPhrapNotToOverlapMultiplyDiscrepantReads: true bool ! This will find all locations where there are multiple identical ! discrepancies with the consensus (and some other conditions) and try ! to make most of the reads quality 99 at that location so that phrap, ! next time it is run, will not overlap those reads. This will fix ! many misassemblies. ! (YES) consed.autoEditTagEditableLowConsensusQualityRegions: true bool ! This will find regions that are low quality, but that a human ! finisher could easily determine the correct base and thus ! money could be saved by not having Autofinish suggest additional ! reads overlapping the region ! (YES) consed.autoEditRecalculateHighQualitySegmentsOfReads: false bool ! If true, will recalculate the high quality segments of the reads ! (YES) ---------------------------------------------------------------------------- USING AUTOREPORT Autoreport is a command-line (non-graphical) method of running consed to report information about the assembly. You run autoreport as follows: consed -ace (acefile) -autoreport You tell autoreport what information you want via the .consedrc file (see CONSED CUSTOMIZATION). The following .consedrc resources are currently available: consed.autoReportPrintHighlyDiscrepantRegions: false (This is the report version of the "Search for highly discrepant positions" described above when using solexa reads.) consed.autoReportPrintScaffolds: false consed.autoReportPrintHighQualityDiscrepancies: false consed.autoReportHighQualityDiscrepanciesExcludeCompressionOrG_dropoutTags: true ! used in connection with consed.autoReportPrintHighQualityDiscrepancies consed.autoReportHighQualityDiscrepanciesExcludeMostPads: true ! used in connection with consed.autoReportPrintHighQualityDiscrepancies consed.autoReportPrintLowConsensusQualityRegions: false consed.autoReportPrintSingleSubcloneRegions: false consed.autoReportPrintLinkingForwardReversePairs: false consed.autoReportPrintFilteredInconsistentForwardReversePairs: false To make autoreport print out one of these lists, you simply change the "false" to "true" in your .consedrc file (see CONSED CUSTOMIZATION elsewhere in this document). 217) Let's try the consed.autoReportPrintHighlyDiscrepantRegions feature. Type: cd solexa_example_answer/edit_dir (You might need to type "cd ../.." first depending on which directory you are currently in.) ls You should see a file ref.ace.1 218) Create a file .consedrc in this directory with the following in it: consed.autoReportPrintHighlyDiscrepantRegions: true consed.navigateByHighlyDiscrepantPositionsMinDiscrepantReads: 2 consed.navigateByHighlyDiscrepantPositionsMaxDepthOfCoverage: 100000 consed.navigateByHighlyDiscrepantPositionsIgnoreBasesBelowThisQuality: 20 consed.navigateByHighlyDiscrepantPositionsJustListIndels: false consed.navigateByHighlyDiscrepantPositionsIgnoreOtherReadsStartingAtSameLocation: false These options were explained above under "Search for highly discrepant positions". 219) Type: consed -ace ref.ace.1 -autoreport 220) Type: ls You will see a file auto.fof which will contain the name of another file ending with .out That file will end with the following: printHighlyDiscrepantRegions { Highly Discrepant Positions min # of discrepant reads: 2 min quality: 20 "r": base of reference seq max depth of coverage: 100000 and ignoring reference seq A C G T * pos contig 1 3.1% 0 0.0% 30 93.8%r 1 3.1% 0 0.0% 72 ref 2 5.6% 34 94.4%r 0 0.0% 0 0.0% 0 0.0% 252 ref 2 6.7% 28 93.3%r 0 0.0% 0 0.0% 0 0.0% 338 ref 0 0.0% 0 0.0% 28 93.3%r 2 6.7% 0 0.0% 453 ref 2 6.1% 31 93.9%r 0 0.0% 0 0.0% 0 0.0% 505 ref 2 4.7% 41 95.3%r 0 0.0% 0 0.0% 0 0.0% 742 ref 2 7.1% 26 92.9%r 0 0.0% 0 0.0% 0 0.0% 936 ref 2 7.7% 24 92.3%r 0 0.0% 0 0.0% 0 0.0% 938 ref } printHighlyDiscrepantRegions This output is explained above under "Search for highly discrepant positions". 221) cd to standard/edit_dir (You might need to type "cd ../.." first depending on which directory you are currently in.) ls 222) Make your .consedrc have the following in it: consed.autoReportPrintLowConsensusQualityRegions: true consed.autoReportPrintSingleSubcloneRegions: true 223) Run autoreport as follows: consed -ace standard.fasta.screen.ace.1 -autoreport (where "consed" must be replaced by whatever command your system administer says to use). You will see something like this: > consed -ace standard.fasta.screen.ace.1 -autoreport couldn't open readOrder.txt--that's ok opened file standard.070918.162756.out for output Now setting quality values Number of individual phd files read: 24 Total reads in assembly: 24 Finished setting quality values in 0 seconds see standard.070918.162756.out 224) Look at standard.070918.162756.out (where the 070918.162756 will be replaced by the current date and time). Scroll down to the bottom (where the important information is) and you will see: lowConsensusQualityRegions { Contig1 (consensus) 1-83 base quality below threshold Contig1 (consensus) 85-110 base quality below threshold Contig1 (consensus) 113-117 base quality below threshold Contig1 (consensus) 120-156 base quality below threshold Contig1 (consensus) 159-166 base quality below threshold Contig1 (consensus) 168-171 base quality below threshold Contig1 (consensus) 185-187 base quality below threshold Contig1 (consensus) 189-190 base quality below threshold Contig1 (consensus) 192 base quality below threshold Contig1 (consensus) 194-199 base quality below threshold Contig1 (consensus) 269 base quality below threshold Contig1 (consensus) 271-275 base quality below threshold Contig1 (consensus) 2584-2591 base quality below threshold } lowConsensusQualityRegions singleSubcloneRegions { Contig1 (consensus) 1-199 199 bp single subclone Contig1 (consensus) 2588-2591 4 bp single subclone } singleSubcloneRegions This gives the low consensus quality regions and the single subclone regions. ---------------------------------------------------------------------------- ADVANCED PHRAP/CONSED USAGE 225) BACKING OUT EDITS AFTER YOU HAVE SAVED THE ASSEMBLY If you decide that all your edits are terrible and you want to start over (perhaps you have been training a new finisher), the cleanest solution is to delete everything in phd_dir and edit_dir , but leave everything in chromat_dir and just run phredPhrap again. 226) SELECTIVELY BACKING OUT EDITS AND REMOVING READS If you want to back out all edits in just particular reads, I have provided a perl script to do this: revertToUneditedRead (read name) What it does it copy the .phd.1 to 1 greater than the highest version. Then you must reassemble using the phredPhrap script to create an ace file that has no edits for that particular read. It will have all edits for all other reads. Why doesn't it just delete all phd files except for the .phd.1? In that case, Consed could not read any previous ace file since all previous versions of ace files would refer to phd files that have been deleted. 227) REMOVING READS FROM AN ASSEMBLY Create a file containing the filename of all the reads you want to remove, one filename per line. Then use the perl script removeReads Then reassemble using the phredPhrap script. 228) ADDING READS WITHOUT CHROMATOGRAM FILES This may happen if you, for example, download sequence from Genbank and want to assemble it along with your reads. There are 2 ways to do this, depending on whether you want to edit the read or not. a) If you want to edit the read, run mktrace to produce a fake trace. It will have all perfect peaks. Run: mktrace (name of file with fasta sequence) Then run the phredPhrap script normally. You will be able to bring up the traces in Consed and edit the read. b) If it is not important to edit the reads, there is a method that is a little faster. Create just a fake phd file using: fasta2Phd.perl (name of file with fasta sequence) It will create a file whose name is taken from the fasta file name: for example, if the fasta filename is Contig1.c.fasta, then the phd file will be called Contig1.c.phd.1 The fasta name in the file is ignored. You can then put this in the phd_dir, and reassemble using the phredPhrap script. If the reads are really fake (you don't want the templates to be chosen by Consed/Autofinish as a template for a primer), then the read should end with an extension .c or .a or .c1 or .c2 ... or .a1 or .a2 or ... This indicates to Consed/Autofinish that the read is a fake read. Note: when you are creating phd files such as this, you must start with (read name).phd.1 Do not start with (read name).phd.2 or any higher version number. This is because Consed looks for the .1 version in order to find the original phred calls so it expects there to be a .1 version. There is also a publicly contributed script "lib2Phd.perl" that takes a fasta file that contains more than one sequence and makes phd files for each of them. 229) ALIGNING READS TO A BACKBONE If you sequence the same region (in different people or in different species), then you may want them all aligned together, even if phrap doesn't want to put them all together. To align them all together, first use a reference sequence and make an assembly out of it by using mktrace or fasta2Phd.perl (see above) followed by phd2Ace.perl (see above). Then add all of the other reads using Consed's Add New Reads feature (either automated or manual--see above). 230) COMPARING READS TO A REFERENCE SEQUENCE The reference sequence, as in the step above, will just be another read in the assembly. Let's call it "ref". To compare the other reads to it, in the Aligned Reads Window, point at the Navigate Menu, hold down the left mouse button and release on "Compare Reads To Reference Sequence". A Window labelled "Enter Name of Reference Read" will pop up. Enter the name of the read and click "OK". A list of high quality read positions that disagree with the reference read will be displayed. 231) TAGGING ALL READS AT ONCE Follow the instructions for tagging the consensus, but when the list of tag types pops up, click the "tag all reads" box at the top of this list. Then continue as with tagging the consensus. 232) EDITING ALL READS AT ONCE Please don't do this. Not unless you REALLY know what you are doing and have a good reason for doing so. You should really only change a base call if you are looking at the chromatogram and thus have a basis in that read for making the change. If you are determined to do this in spite of my pleas and protests, do the following. Suppose that at a particular consensus position some reads have "a" and some "c" and you want them all to be "a". In the Aligned Reads Window, point to an "a" at that position, hold down the left mouse button and release on "make all reads a". The reason you shouldn't do this is that perhaps the reads that were "c" were actually correct and were a different copy of a repeat. Hence the reads with "a" and the reads with "c" did not really overlap. But you just destroyed the evidence. 233) FASTER CONSED STARTUP You can greatly speed up Consed startup if you are willing to use more disk space. The disk space used will be about equal to the total space used by the PHD files. Try this will a large dataset (you won't notice any difference with the test datasets that come with Consed.) To use this method of startup: 1) cd to directory where ace file is kept 2) type: makePhdBall.perl (This will create a file called phd.ball which is big.) 3) start consed normally In many situations, this will greatly speed up Consed startup. The amount of speedup depends on which operating system is used: on Linux, the time to read phd files dropped from 75 seconds to 8 seconds, and thus the total time to start up consed dropped from 86 seconds to 17 seconds. I saw similar speedups on Solaris where the phd files are on an nfs mounted disk. However, there was another situation in which the startup time was the same. Warning: If you create phd.ball as above, Consed will be reading most phd files from phd.ball instead of from ../phd_dir. If you delete phd files in phd_dir, you must also delete phd.ball. Otherwise Consed will give lots of error messages "TIME STAMP MISMATCH" and many things will not work correctly. 234) VIEWING THE CHROMATOGRAM OF SINGLETS OR NON-ASSEMBLED READS If you have a chromatogram, you can use Consed to view it, even if it hasn't been assembled into the ace file. This is common with cDNA assemblies in which the reads don't overlap and thus phrap doesn't put them together into a contig. To do this, make the same edit_dir, phd_dir, and chromat_dir as above, put the chromatogram into chromat_dir, run phred on it to generate the phd file which goes into phd_dir. Then go to edit_dir and run: phd2Ace.perl (name of phd file) For example, if your phd file is myRead.phd.1 from edit_dir, type: phd2Ace.perl myRead.phd.1 This will produce myRead.ace Then just start Consed normally: consed -ace myRead.ace and you can view the chromatogram. 235) HIDING SOME TYPES OF TAGS If you have many tags that overlap and thus are purple, you can hide some less relevant tag types so there is less purple and there is less distraction. Make sure you have a few tags visible. Then click on 'Find Main Win'. In the Main Window, open the Options menu, and release on 'Hide Some Tag Types'. A list of tag types will pop up. Select the type that you have visible (above). Then click 'OK'. Go back to the Aligned Reads Window. That tag should still be visible. Click on the button 'Some Tags' in the upper right part of the Aligned Reads Window. Your tag should disappear. The 'Some Tags' button should have changed to 'Sh All Tags'. Click on it again. Your tags should have reappeared. 236) CUSTOM CONTIG NAMES Normally, when you re-assemble, phrap will name the contigs differently--what was Contig31 before may become Contig32. To help you know which contig is which, Consed allows you to give a name (e.g., "A") to a contig which will persist after re-assembling. To do this, swipe some consensus bases with the middle mouse button (as above). When the "Select Tag Type" box pops up, click on "contigName" and also type a name into the "Contig Name:" field and then click "OK". The next time you re-assemble, the name "A" will appear in the list of contigs on the Consed Main Window. 237) MULTIPLE TRACE POPUP Bring up dataset standard. In the Aligned Reads window, scroll to a region that has many reads and that has some discrepancies--try position 1162. Hold down the shift key, and click with the middle mouse button on the consensus. At this location 3 traces will pop up--these are the 2 highest quality traces that agree with the consensus (on each strand) and the highest quality trace that disagrees with the consensus. This feature is useful in areas of high coverage when you want to rapidly examine just the most significant traces rather than looking at all of them. 238) MAXIMUM NUMBER OF TRACES DISPLAYED Bring up dataset standard. Scroll to position 1162. Bring up 4 reads and then try bringing up additional reads.You will notice that new reads are put at the top of the stack of traces and, once there are 4 traces displayed, traces are automatically removed from the bottom of the stack. If you want to change this maximum number of traces to something besides 4, you can do that: In the Consed Main Window (click on 'Find Main Win' on the Aligned Reads window), pull down the 'Options' menu, and release on 'General Preferences'. Try changing the 'Max Number of Traces Shown' to 3. Then click 'Apply and Dismiss'. Now dismiss the Trace Window and again start adding additional traces to the Trace Window. You will notice that now the number of traces shown will not exceed 3. If you want to view a large number of traces at once, you should use the SHOW ALL TRACES (described above). 239) SCALING THE TRACES In the Trace Window, grab the thumb of the line that is labelled "V" (for Vertical magnification) and move it back and forth, noticing the effect on the traces. This is useful if the traces are too small or too large. There are several other methods of scaling the traces you will learn later. 240) HOTKEYS FOR EDITING If you do a lot of editing, you will want to have a faster method of doing these edits than having the popup and selecting an option. Thus the following hot keys exist: < and > (less than and greater than) to make n's to the left and the right (respectively) of the cursor control-l and control-r to make low quality to the left and the right (respectively) of the cursor overstriking with a capital letter (e.g., C instead of c) causes the base to become high quality rather than low quality overstriking with a lower case letter causes the base to become low quality Give these a try. 241) SCROLLING TRACES INDEPENDENTLY Dismiss all of your Trace Windows. Then pop up traces for 2 different reads in approximately the same location. Scroll one of them. You may want to scroll by clicking the arrows or clicking to the left or right of the thumb. You will notice that both will scroll. Consed will do its best to have corresponding peak lined up. (Consed can't line all of them up because the peak spacing is not uniform and differs from read to read.) Try removing a trace by clicking on one of the 'Remove' buttons in the Trace Window. Try adding other traces. Then click on 'No' for scrolling the traces together and try scrolling. You will now observe that they scroll separately. 242) ABI BASE CALLS If you want to see the ABI base calls, no problem. Just go to the Consed Main Window. Pull down the 'Options' menu and release on 'General Preferences'. Click on 'True' for 'Show ABI Bases in Trace Window' and then click 'OK' at the bottom of the window. The ABI bases will not be shown immediately--you must first dismiss the trace window and bring it up again. You will then see an additional line with the ABI base calls. 243) MEASURING ERROR RATE AND SINGLE SUBCLONE BASES FOR A REGION Some contigs have long tails of low quality bases and you would like to find out the error rate for the contig without that long tail. On the Align Reads Window, pull down the Misc menu, and release on 'Show Errors for a Region'. This will tell you both the error rate for the region and the number of single subclone bases for that region. 244) PREVENTING 2 USERS FROM MAKING CONFLICTING EDITS If there are 2 users that are both editing in the same directory, there is the possibility they will both make edits to the same read. Whoever saves their assembly last will wipe out the edits of the other person, even if they were using different ace files. To help prevent this, consed can warn you if someone else is making edits in the same directory. Set the consed parameter: consed.onlyAllowOneReadWriteConsedAtATime: true The default is "false" so you have to turn this to true to make it work (see CONSED CUSTOMIZATION). This will usually work even if the 2 users are on different computers (and the directory is nfs-mounted between them) and even if the different computers have different operating systems. I've tested the following combinations: user 1 on Solaris; user 2 on Solaris user 1 on Linux; user 2 on Linux user 1 on Solaris; user 2 on Alpha (Digital Unix) user 1 on Linux; user 2 on Solaris <--- does not work Only the last combination doesn't work. 245) PRINTING CONSED WINDOWS There is a free (or nearly free) program called "xv". One web site is http://www.trilon.com/xv It is written by one of those dying breed of UNIX programmers who just *loved* UNIX and programming and sharing it. His web site is enjoyable because some of his passion comes through. With xv, you can make a postscript file from a Consed window. Then you can print the postscript file on a color printer. However, since some Consed windows are mostly black (Aligned Reads Window and Traces Window), this uses up a lot of toner and is difficult to read. So go to the Consed Main Window, pulldown the 'Options' menu and release on 'General Preferences'. Scroll down to "Make light background in Aligned Reads Window..." and click on "Do it now". Dismiss any Aligned Reads Windows or Traces Windows and then bring them back up. You will notice the light background. A few other things (traces colors and thickness) are also customized for making color prints. 246) COLOR MEANS MATCH In the Aligned Reads Window, go to the menu labelled 'color', and pulldown and release on 'color means match'. Now you notice different colors: The colors have the following meaning: Blue: agrees with consensus Orange: disagrees with consensus Yellow: this stretch of this read was used by phrap to form the consensus Grey: Low quality or unaligned ends of reads -------------------------------------------------------------------------- NOTE TO LINUX USERS (32 bit) Do you know for a fact that your computer is not a 64 bit computer? If it is, download consed_linux64bit instead of this version because the 64 bit version will allow you to use consed on larger assemblies. We have found that there is a large variation among different linux systems (even those with the same kernel) so I have provided 2 different executables (consed_linux32bit and consed_linux32bit_dyn) in the hope that one will work for you. With one of them, consed may not come up at all but rather terminate with an error such as the following: > ./consed ./consed: error while loading shared libraries: libstdc++-libc6.2-2.so.3: cannot open shared object file: No such file or directory or > ./consed: symbol regexec, version GLIBC_2.3.4 not defined in file libc.so.6 with link time reference (See below for suggestions from Consed/linux users with similar experiences.) 247) If Consed does come up, do the following test: Bring up Consed with the standard dataset as shown in QUICK TOUR OF CONSED (above) and open standard.fasta.screen.ace.1 as shown in the QUICK TOUR. After Consed is up, on the Main Consed Window there is a menu "Help" on the top right. Push the left mouse button down on Help menu. There will be a list of choices that will appear. While still holding down the left mouse button, drag the cursor to "Test Exception Handling" and release the left mouse button. If a popup window appears with a "Dismiss" button, you are fine (but you should still read the rest of this note). If Consed terminates, then this Consed executable does not work with the exception handling shared libraries you have installed. Try a different consed executable or find different shared libraries, as discussed below. If you are using consed_linux2.4, in /usr/lib, there must be a file: libstdc++-libc6.2-2.so.3 If you try to run consed and this is missing, you will see an error message like this: > ./consed ./consed: error while loading shared libraries: libstdc++-libc6.2-2.so.3: cannot open shared object file: No such file or directory I have provided this file in case you don't have it. Just put it in /usr/lib and see if that fixes the problem. One consed user reports: did a little poking around and found that i needed: compat-libstdc++-7.3-2.96.118 RPM for i386 since i'm running fedora core 1 at the moment. ... Anyway, if anyone gets this error tell them they're missing the Standard C++ libraries for Red Hat 7.3 backwards compatibility compiler and it can be downloaded here: http://www2.linuxforum.net/RPM/fedora/core/1/Fedora/RPMS/compat-libstdc++-7.3-2.96.118.i386.html If you get warnings like this: Warning: String to TranslationTable conversion encountered errors Warning: translation table syntax error: Unknown keysym name: osfActivate Warning: ... found while parsing ':osfActivate: PrimitiveParentActivate()' it can be fixed by: export XKEYSYMDB=/usr/share/X11/XKeysymDB If you can't cut and paste (e.g., if you highlight a segment of the consensus sequence, you should be able to paste it into the search window. It gets highlighted, but nothing gets pasted), fix it by: using the dynamic executable: consed_linux2.6_dyn which will require libXm.so.3 If you have libXm.so.4.0.0 but not libXm.so.3, you might have to: ln -s /usr/lib/libXm.so.4.0.0 /usr/lib/libXm.so.3 (It looks like libXm.so.4.0.0 comes from openmotif-2.3.0-0.1.9.3) One Consed user reported the following error message: "Consed error : could not allocate colormap entry for color "yellow". This may be due to a spelling error in your color name. Or this may be because some other application is a hog. If it is netscape, run netscape via netscape -install" He said that the fix above (consed_linux2.6_dyn and libXm.so.3) fixed this problem as well. Another Consed system administration said: "I got the error: ../../consed_linux: error while loading shared libraries: libstdc++-libc6.2-2.so.3: cannot open shared object file: No such file or directory In order to resolve the issue on linux boxes you need to install the compatibility libraries. "To be on the safe side I installed the following compat-libstdc++-33.i386 3.2.3-61 gcc-c++.i386 4.1.2-14.el5 gcc.i386 4.1.2-14.el5 cpp.i386 4.1.2-14.el5 libstdc++-devel.i386 4.1.2-14.el5 libgomp.i386 4.1.2-14.el5 libstdc++.i386 4.1.2-14.el5 libgcc.i386 4.1.2-14.el5 "I believe you may get away with just the first compat-libstdc package." ---------------------------------------------------------------------------- NOTE TO LINUX USERS (64 BIT) I've supplied two executables: consed_amd64 (statically linked) and consed_amd64_dyn (dynamically linked). Try the first one first. If Consed doesn't come up at all, then try the second one. The kind of problems you might have would cause consed to immediately terminate, so if consed comes up at all (you can see the Consed Main Window), that particular executable is fine for you. (See QUICK TOUR OF CONSED for how to start Consed--you must be in the correct directory.) -------------------------------------------------------------------------- NOTE TO ITANIUM LINUX USERS In /usr/lib, there must be a file: libstdc++-libc6.2-2.so.3 If you try to run consed and this is missing, you will see an error message like this: > ./consed ./consed: error while loading shared libraries: libstdc++-libc6.2-2.so.3: cannot open shared object file: No such file or directory If you don't have this file already, I have provided it for you in with the linux consed distribution. -------------------------------------------------------------------------- NOTE TO SGI USERS In /usr/lib, there must be a file: libCsup.so If you don't have this file, you must get it from SGI. To get it, if you are on Irix 6.2 through 6.4, request: SG0001637 'C++ Exception handling patch for 7.00 (and above) compilers on irix 6.2' (it's on the 'Development Options 7.1' CD). If you are on Irix 5.3, install patch 1600 To make things easier for you, I've included my libCsup.so This might save you having to get the patches above. This is a 64 bit executable so you can use it for large datasets (over 100,000 reads). ---------------------------------------------------------------------------- NOTE TO SOLARIS USERS A. Do not use /usr/ucb/cc !!! How can you tell if you are using it? Type: which cc If it says /usr/ucb/cc, you must get gcc or else buy the commercial cc from Sun (which is /opt/SUNWspro/bin/cc). If you use /usr/ucb/cc, strange things will happen, including phd2fasta not working correctly by cutting off the first 2 characters of read names. B. If you are using large files or datasets, please use the executable consed_solaris64. The other one will not be able to handle files larger than 2Gb. ---------------------------------------------------------------------------- NOTE TO MACOSX USERS You must have an X environment on your MAC and you must turn it on. If you don't know how to do this, find someone locally who can help you. If you don't have an X environment already on your MAC, download from Apple at www.apple.com/software I suggest you use XDarwin in full screen mode. Use option-apple-A to move back and forth between the MAC desktop and the X environment. If you have a 1-button mouse, I've found that: apple-click = right button click option-click = middle button click (some people said the reverse of this) One Consed user who is experienced in macosx says that XDarwin is not so friendly and instead suggests running the X11 version found at: http://www.apple.com/downloads/macosx/apple/x11formacosx.html or else OroborOSX (http://oroborosx.sourceforge.net/), and a new (non-beta) version is available (http://oroborosx.sourceforge.net/download.html). Please edit the phredPhrap to reflect the correct location of nice (there is a note in the phredPhrap script about this). ---------------------------------------------------------------------------- CONSED CUSTOMIZATION If you want to customize Consed, it would help to be able to edit in UNIX. There is no Microsoft Word in UNIX, but there is emacs, vi, pico, nano and other editors. You must learn one of these if you are going to use the phred/phrap/consed/autofinish system effectively. I suggest pico or nano for their simplicity. (You can get more information by googling, for example, "pico unix editor".) Point at the 'Info' menu on the Consed Main Window, hold down the left mouse button and release on menu item 'Show Current Consed Parameters'. This shows you what is available to be changed by putting in your ~/.consedrc file. Point at the 'Info' menu on the Consed Main Window, hold down the left mouse button and release on menu item 'Show Default X Resources'. This shows you what is available to be changed by putting in your ~/.Xdefaults file. Point at the 'Options' menu on the Consed Main Window, hold down the left mouse button and release on menu item 'Edit Consed/Autofinish Parameters'. This includes most of the parameters found under 'Info/Show Current Consed Parameters' (above). It provides an easy graphical way for you to edit these parameters, if you are not familiar with editing under UNIX. You just change the parameter you want and click "Save". (See HOW TO CHANGE CONSED/AUTOFINISH PARAMETERS (far above)). For the new parameter to take effect, you must restart Consed/Autofinish. Changes in ~/.consedrc only affect one user. If you want to make a change to affect all Consed users on the system, put a file in some central location (e.g., /usr/local/genome/lib/.consedrc ) and then have every user set the environment variable CONSED_PARAMETERS to that the full pathname of the file. For example, if using csh or tcsh, type: setenv CONSED_PARAMETERS /usr/local/genome/lib/.consedrc If using bash, type: CONSED_PARAMETERS=/usr/local/genome/lib/.consedrc export CONSED_PARAMETERS Anything the user puts in ~/.consedrc will override whatever is in the CONSED_PARAMETERS file. You can also have different parameters for different projects. Put a .consedrc file in the edit_dir of a particular project. When you are working on that project, whatever is in that .consedrc will override whatever is in your ~/.consedrc file or the CONSED_PARAMETERS file. CUSTOMIZING NAVIGATE BY SINGLE STRANDED REGIONS AND NAVIGATE BY SINGLE SUBCLONE REGIONS You can set the parameters: consed.searchFunctionsUseUnalignedEndsOfReads: false consed.searchFunctionsUseLowQualityEndsOfReads: true If you set consed.searchFunctionsUseUnalignedEndsOfReads to be false, then the unaligned ends of a read are not considered to cover the consensus. If you set consed.searchFunctionsUseLowQualityEndsOfReads to false, then the low quality ends of a read are not considered to cover the consensus. For example, if the settings are: consed.searchFunctionsUseUnalignedEndsOfReads: false consed.searchFunctionsUseLowQualityEndsOfReads: false then a base in a read is only considered to cover the consensus if it is both in the aligned portion of the read and the high quality portion of the read. 248) .consedrc vs .Xdefaults Although most Consed parameters now go into .consedrc, there are still a very few that need to stay in .Xdefaults. Here is the rule: if the parameter starts with consed. such as consed.gunzipFullPath: /bin/uncompress then it goes into .consedrc If the resource (here it is called a "resource" rather than a "parameter") starts with consed* such as consed*contigwin.background: Black then it goes in .Xdefaults 249) MAKING LIGHT BACKGROUND FOR SLIDES Put the following into your .consedrc consed.makeLightBackgroundInAlignedReadsWindowAndTracesWindow: true 250) COLOR BLINDNESS One person with Red/Green colorblindness (Deutan), found the following colors helpful: consed.colorTracesG: Yellow consed.colorTracesA: forest green consed.colorTracesC: medium blue consed.colorTracesT: light coral Put these in a .consedrc in your home directory. ---------------------------------------------------------------------------- CONSED FOR LARGE ASSEMBLIES OR HUGE ASSEMBLIES This section only applies to assemblies that have 10,000 reads or more and/or is of a multi-megabase region. 251) To speed up the time for Consed to start up, follow instructions for FASTER CONSED STARTUP (above). Please do this--otherwise you will die of old age waiting for Consed to startup (well, it would take hours anyway). With one bacterial genome assembly with 73,000 reads, using this faster startup method it takes consed 4 minutes to startup--just enough time for coffee. 252) Enough memory is vital with large assemblies. In csh or tcsh type: limit You should see something like this: cputime unlimited filesize unlimited datasize 2097148 kbytes stacksize 8192 kbytes coredumpsize 0 kbytes vmemoryuse unlimited descriptors 64 Type: limit datasize unlimited Then type: limit just to see that the number has changed. 253) Make sure you have enough swap space to support the amount of RAM on the computer. 254) Some operating systems and computer hardware is inadequate to support programs requiring large amounts of memory. Our experience is that older versions of Linux will not allow a single process to consume all (or even most) of available memory. More recent versions of linux will allow up to 2Gb, but we haven't seen it allow more. If you need more than 4Gb of memory, you have exceeded the addressing limit of any 32-bit computer, regardless of operating system, and you must use a 64-bit computer: an alpha, Itanium, AMD64, SGI, IBM or Solaris Sparc running in 64 bit mode. Normal PCs are 32-bit computers, and therefore won't work for large datasets. ---------------------------------------------------------------------------- FOR PROGRAMMERS AND FELLOW TRAVELLERS ONLY 255) COMPRESSING CHROMATOGRAMS If you are interested in compressing your chromatogram files, go into chromat_dir and gzip one of the chromatogram files. Make sure that gunzip is in /usr/local/bin (You can change this location via the Consed parameter consed.gunzipFullPath: /usr/local/bin/gunzip --see CONSED CUSTOMIZATION (above), but it will be easiest for you and your users if you just put gunzip (or a link to it) in /usr/local/bin and not have to bother with Consed parameters.) Restart Consed and bring up the corresponding trace. You will notice no appreciable delay. 256) READING CHROMATOGRAMS OUT OF AN EXTERNAL DATABASE Normally, chromatograms are kept in ../chromat_dir. If you want to keep them somewhere else (such as in an external database), you can do that. When the chromatogram is needed (when the user asks to view a trace), Consed will call an external program, passing it the name of the read required, and then look for the chromatogram in /tmp (by default). It will read the chromatogram and then delete it. Use the parameters: consed.alwaysRunProgramToGetChromats: true consed.programToRunToGetChromats: /usr/local/bin/programToGetChromat In this case, "programToGetChromat" is the name of the program that gets the chromatogram and puts it into /tmp. 257) CONSED -ACE Try bringing up Consed like this: consed -ace (name of ace file) This can be useful if you are going to have Consed brought up from some other program. 258) NO PHD FILES Try bring up Consed like this: consed -nophd This mode allows you to view an assembly when you don't have phd files or chromatograms but you only have the ace file. I do not recommend nor support this option! There are so many things that do not work with this option that I haven't bothered to keep track of them, but here are a few items: can't make joins, can't recalculate consensus quality, can't view traces, can't edit, autofinish will not give good results, can't view quality of the read bases, ... 259) CREATING CUSTOM TAG TYPES You can add your own tag types by creating a file of your custom tag types. The file looks like this: mytag1 red consensus yes mytag2 purple both yes mytag3 green read no field 1 ("mytag1") is the tag name field 2 ("red") is the color field 3 is "consensus", "read", or "both" depending on which kind of tag it is field 4 is "yes" or "no" depending on whether the user can add this tag in Consed (by swiping) or whether it is a tag that can only be viewed in Consed (presumably it would be added by some software of yours before the user sees it in Consed). If the file is called "/usr/local/genome/lib/tagTypes.txt", then in .consedrc put the following line: consed.fileOfTagTypes: /usr/local/genome/lib/tagTypes.txt so that Consed knows where the file is. Once you have done this, the user of Consed can add tags of these types in the method described in TAGS of the Quick Tour (above). The list of available colors is found in the file rgb.txt found in /usr/lib/X11/rgb.txt on Linux or /usr/openwin/lib/rgb.txt on Solaris. For more information, consult any X-Windows reference, since this has nothing to do specifically with Consed. For your convenience, here are most of the color names. One way to find out what they look like is to try them: snow SlateBlue2 coral1 ghost white SlateBlue3 coral2 white smoke SlateBlue4 coral3 gainsboro RoyalBlue1 coral4 floral white RoyalBlue2 tomato1 old lace RoyalBlue3 tomato2 linen RoyalBlue4 tomato3 antique white blue1 tomato4 papaya whip blue2 OrangeRed1 blanched almond blue3 OrangeRed2 bisque blue4 OrangeRed3 peach puff DodgerBlue1 OrangeRed4 navajo white DodgerBlue2 red1 moccasin DodgerBlue3 red2 cornsilk DodgerBlue4 red3 ivory SteelBlue1 red4 lemon chiffon SteelBlue2 DeepPink1 seashell SteelBlue3 DeepPink2 honeydew SteelBlue4 DeepPink3 mint cream DeepSkyBlue1 DeepPink4 azure DeepSkyBlue2 HotPink1 alice blue DeepSkyBlue3 HotPink2 lavender DeepSkyBlue4 HotPink3 lavender blush SkyBlue1 HotPink4 misty rose SkyBlue2 pink1 white SkyBlue3 pink2 black SkyBlue4 pink3 dark slate gray LightSkyBlue1 pink4 dim gray LightSkyBlue2 LightPink1 slate gray LightSkyBlue3 LightPink2 light slate gray LightSkyBlue4 LightPink3 gray SlateGray1 LightPink4 light grey SlateGray2 PaleVioletRed1 midnight blue SlateGray3 PaleVioletRed2 navy SlateGray4 PaleVioletRed3 cornflower blue LightSteelBlue1 PaleVioletRed4 dark slate blue LightSteelBlue2 maroon1 slate blue LightSteelBlue3 maroon2 medium slate blue LightSteelBlue4 maroon3 light slate blue LightBlue1 maroon4 medium blue LightBlue2 VioletRed1 royal blue LightBlue3 VioletRed2 blue LightBlue4 VioletRed3 dodger blue LightCyan1 VioletRed4 deep sky blue LightCyan2 magenta1 sky blue LightCyan3 magenta2 light sky blue LightCyan4 magenta3 steel blue PaleTurquoise1 magenta4 light steel blue PaleTurquoise2 orchid1 light blue PaleTurquoise3 orchid2 powder blue PaleTurquoise4 orchid3 pale turquoise CadetBlue1 orchid4 dark turquoise CadetBlue2 plum1 medium turquoise CadetBlue3 plum2 turquoise CadetBlue4 plum3 cyan turquoise1 plum4 light cyan turquoise2 MediumOrchid1 cadet blue turquoise3 MediumOrchid2 medium aquamarine turquoise4 MediumOrchid3 aquamarine cyan1 MediumOrchid4 dark green cyan2 DarkOrchid1 dark olive green cyan3 DarkOrchid2 dark sea green cyan4 DarkOrchid3 sea green DarkSlateGray1 DarkOrchid4 medium sea green DarkSlateGray2 purple1 light sea green DarkSlateGray3 purple2 pale green DarkSlateGray4 purple3 spring green aquamarine1 purple4 lawn green aquamarine2 MediumPurple1 green aquamarine3 MediumPurple2 chartreuse aquamarine4 MediumPurple3 medium spring green DarkSeaGreen1 MediumPurple4 green yellow DarkSeaGreen2 thistle1 lime green DarkSeaGreen3 thistle2 yellow green DarkSeaGreen4 thistle3 forest green SeaGreen1 thistle4 olive drab SeaGreen2 gray0 dark khaki SeaGreen3 gray1 khaki SeaGreen4 gray2 pale goldenrod PaleGreen1 gray3 light goldenrod yellow PaleGreen2 gray4 light yellow PaleGreen3 gray5 yellow PaleGreen4 gray6 gold SpringGreen1 gray7 light goldenrod SpringGreen2 gray8 goldenrod SpringGreen3 gray9 dark goldenrod SpringGreen4 gray10 rosy brown green1 gray11 indian red green2 gray12 saddle brown green3 gray13 sienna green4 gray14 peru chartreuse1 gray15 burlywood chartreuse2 gray16 beige chartreuse3 gray17 wheat chartreuse4 gray18 sandy brown OliveDrab1 gray19 tan OliveDrab2 gray20 chocolate OliveDrab3 gray21 firebrick OliveDrab4 gray22 brown DarkOliveGreen1 gray23 dark salmon DarkOliveGreen2 gray24 salmon DarkOliveGreen3 gray25 light salmon DarkOliveGreen4 gray26 orange khaki1 gray27 dark orange khaki2 gray28 coral khaki3 gray29 light coral khaki4 gray30 tomato LightGoldenrod1 gray31 orange red LightGoldenrod2 gray32 red LightGoldenrod3 gray33 hot pink LightGoldenrod4 gray34 deep pink LightYellow1 gray35 pink LightYellow2 gray36 light pink LightYellow3 gray37 pale violet red LightYellow4 gray38 maroon yellow1 gray39 medium violet red yellow2 gray40 violet red yellow3 gray41 magenta yellow4 gray42 violet gold1 gray43 plum gold2 gray44 orchid gold3 gray45 medium orchid gold4 gray46 dark orchid goldenrod1 gray47 dark violet goldenrod2 gray48 blue violet goldenrod3 gray49 purple goldenrod4 gray50 medium purple DarkGoldenrod1 gray51 thistle DarkGoldenrod2 gray52 snow1 DarkGoldenrod3 gray53 snow2 DarkGoldenrod4 gray54 snow3 RosyBrown1 gray55 snow4 RosyBrown2 gray56 seashell1 RosyBrown3 gray57 seashell2 RosyBrown4 gray58 seashell3 IndianRed1 gray59 seashell4 IndianRed2 gray60 AntiqueWhite1 IndianRed3 gray61 AntiqueWhite2 IndianRed4 gray62 AntiqueWhite3 sienna1 gray63 AntiqueWhite4 sienna2 gray64 bisque1 sienna3 gray65 bisque2 sienna4 gray66 bisque3 burlywood1 gray67 bisque4 burlywood2 gray68 PeachPuff1 burlywood3 gray69 PeachPuff2 burlywood4 gray70 PeachPuff3 wheat1 gray71 PeachPuff4 wheat2 gray72 NavajoWhite1 wheat3 gray73 NavajoWhite2 wheat4 gray74 NavajoWhite3 tan1 gray75 NavajoWhite4 tan2 gray76 LemonChiffon1 tan3 gray77 LemonChiffon2 tan4 gray78 LemonChiffon3 chocolate1 gray79 LemonChiffon4 chocolate2 gray80 cornsilk1 chocolate3 gray81 cornsilk2 chocolate4 gray82 cornsilk3 firebrick1 gray83 cornsilk4 firebrick2 gray84 ivory1 firebrick3 gray85 ivory2 firebrick4 gray86 ivory3 brown1 gray87 ivory4 brown2 gray88 honeydew1 brown3 gray89 honeydew2 brown4 gray90 honeydew3 salmon1 gray91 honeydew4 salmon2 gray92 LavenderBlush1 salmon3 gray93 LavenderBlush2 salmon4 gray94 LavenderBlush3 LightSalmon1 gray95 LavenderBlush4 LightSalmon2 gray96 MistyRose1 LightSalmon3 gray97 MistyRose2 LightSalmon4 gray98 MistyRose3 orange1 gray99 MistyRose4 orange2 gray100 azure1 orange3 dark grey azure2 orange4 dark blue azure3 DarkOrange1 dark cyan azure4 DarkOrange2 dark magenta SlateBlue1 DarkOrange3 dark red DarkOrange4 light green 260) ADDING TAGS FROM OTHER PROGRAMS You can also write external programs that add tags to the ace file and/or the phd files. Both RT (read) and CT (consensus) tags can be appended to the end of the ace file. BEGIN_TAG tags can be appended to the end of the phd files. Do not rewrite the ace file or the phd file--there is no need to do so and it will cause problems. 261) CONTROL OF CONSED FROM SOME OTHER PROGRAM Consed can be controlled by some other program. For example, you might have a program that displays mapping data and you would like the user to be able to click on a location and have Consed come up showing the bases in that region. This feature allows a programmer to do this. Here is an example of how to do this: cd to standard/edit_dir Start consed as follows: consed -socket 5432 -ace standard.fasta.screen.ace.1 If a window pops up asking if you want to apply edits, answer "no". Open another xterm and cd to standard/edit_dir From this directory, run the script testSocket.perl (thanks to Bill Gilliland) which is supplied with consed in the scripts directory of the consed distribution. This script will say: issuing command Scroll Contig1 100 waiting for you to type a command (such as Scroll Contig1 150)... You should immediately see consed's Aligned Reads Window open and scroll automatically to position 100. If you were to type (in the window in which testSocket.perl is running): Scroll Contig1 150 then you would see Consed immediately scroll to position 150. Here are the details of how you could use it: The external program can start up Consed as follows: consed -socket (local port number) -ace (ace filename) For example, consed -socket 5432 -ace standard.fasta.screen.ace.1 After Consed completes coming up (including you clicking whether you want to apply edits), you will see the message in the xterm: success bind to local port number: 5432 And then you will see a file created by Consed in the default directory (which is usually the directory the ace file is in) called consedSocketLocalPortNumber This gives the port number of the Berkeley socket that Consed has opened and is listening on. Thus your program can read this file and create a connection to the Berkeley socket created by Consed. Once the connection is established, your program can send commands to Consed at that socket indicating to Consed which contig to display and what consensus position to scroll to. Currently, the only acceptable commands are: Scroll (contigname) (consensus position) PopupTraces (read name) (unpadded read position in the direction of sequencing) 'Unpadded read position in the direction of sequencing' is the position from the right end, if the read is a bottom strand read. Just send such a command to the Berkeley socket, and Consed will respond appropriately. (Currently, Consed doesn't like it if another process establishes a connection and then terminates without first terminating the connection.) 262) AUTOMATIC ORDERING OF OLIGOS I heard of a finisher who manually ordered 72 oligos. She had to cut/paste the bases of each oligo. That is not only painful, but also error prone. I've supplied you a script that you can use to automatically determine which oligos have been newly requested since the last order, aggregate them into a single order, and email the request off. The script is ace2Oligos.perl. It takes as command line arguments the name of an ace file and the name of the oligo file. The oligo file is a list of oligos that have been ordered for that particular project, and looks like this: name=G1980A181.1 sequence=ctgcatggctaggga template=seq from subclone date=980427 temp=52 name=G1980A181.2 sequence=tcttactttctgactttcattt template=seq from clone date=980427 temp=50 ace2Oligos.perl finds all oligo tags in the ace file and makes sure that all of them are in this oligo file. To automatically order oligos each night, there is an additional script you will have to write. I suggest that you run your script each night under cron and that it do the following: for each project, it will look for the most recent ace file. It will run ace2Oligos.perl on that ace file and direct the oligo file to be in the parent directory of edit_dir, phd_dir, and chromat_dir for that project. Thus there will be one oligos file for each project. Your script will run ace2Oligos.perl once for each project. Then your script would, for each project, look in the oligos file for new oligos, and aggregate the unordered oligos into a central file, which it would email to the oligo company. If it finds any new oligos in an oligo file, it draws a line at the bottom: ------------------------------- which indicates that all oligos have been ordered. When this script looks at this file the next night, it uses this line to determine whether any additional oligos have been requested since the previous order. (The idea of this line came from St Louis.) Thus the oligos file tells you which oligos have been ordered and which have not yet been ordered. ace2Oligos.perl does not record the comments that the finisher entered when creating the oligo. If you want to record that as well, you could use the script ace2OligosWithComments.perl which was written by a Consed user and thus is found in the 'contributions' directory. 263) USER-DEFINED CONSENSUS POSITIONS Suppose instead of labeling the consensus 1, 2, 3, 4, ..., you want, for example, to number it: 100,000,001, 100,000,002, 100,000,003, 100,000,004, etc. (e.g., in chromosome positions). You can do this. Note that all bases in the consensus (except pads) will be numbered--you cannot, for example, only number exon bases and not number intron bases (pity). To start numbering the consensus at a number different from 1, add a "startNumberingConsensus" tag to either the consensus or a read in that contig. The tag will look like this (this is a consensus tag in the ace file): CT{ hs18-25105605_HSap-Contig startNumberingConsensus consed 1 1 041123:152840 25105605 } This says that the consensus will be numbered starting at 25,105,605 You cannot add such a tag by using Consed--you must have a program add it to the ace file (or a phd file of one of the reads in the contig). 264) CUSTOM NAVIGATION In the Main Window, there is also a Navigate menu. Pull it down and release on the Custom Navigation menu item. A box will pop up saying 'Select custom navigation file:' There will be a file: custom_navigation.nav Double click on it. You will see the now-familiar custom navigation box. Click 'Next' repeatedly until you get to the end of the list. Consed doesn't write such a file--it just reads it. This feature allows you the ability to write your own programs that select locations that you want your finishers to examine. Your program writes a file, the user reads that file into Consed in this manner, and you can go to each of the locations. The format of the file is as follows: There is a title line that looks like this: TITLE: low quality base in discrepant region and then there are blocks that look like this: BEGIN_REGION TYPE: READ READ: B11_hs1-60153193_GGor_050426.f UNPADDED_READ_POS: 34 34 COMMENT: a comment END_REGION The block above refers to read position 34 of read B11_hs1-60153193_GGor_050426.f Even if this read is complemented in the assembly (it is right to left), this position refers to the base position in the direction of sequencing--same as the position within the PHD file. There is another kind of block: BEGIN_REGION TYPE: CONSENSUS CONTIG: hs21-15002178_HSap-Contig UNPADDED_CONS_POS: 1774 1784 COMMENT: another comment END_REGION which refers to a position on the consensus. Notice that it is missing the "READ:" line, the TYPE: line is different, and instead of "UNPADDED_READ_POS" it has "UNPADDED_CONS_POS". When someone is navigating, the blinking cursor will be put onto the consensus (with the second kind of block) rather than the blinking cursor on the read (with the first kind of block). You might want to specify the consensus positions in terms of some user-defined positions (the first position of the consensus is not 1 but rather is some other number). For example, you might want to use chromosome positions, rather than the position within the contig. You can let Consed know that the UNPADDED_CONS_POS numbers are user-defined positions by putting the words "user-defined positions" somewhere in the TITLE line like this: TITLE: low quality base in discrepant region (user-defined positions) So that Consed knows what number to start numbering the consensus at, you must have a startNumberingConsensus tag on the consensus or a read indicating the user-defined position of the left-end of the contig. See USER-DEFINED CONSENSUS POSITIONS in this document. There is a 3rd type of block that you probably won't use much. It is used when you know the consensus position within a read, but not the read position. Then you can use: BEGIN_REGION TYPE: READ CONTIG: hs2-105068850_HSap-Contig READ: E02_hs2-105068850_PTro_040520.f UNPADDED_CONS_POS: 295 299 COMMENT: left 2 END_REGION The block above refers to a position on read E02_hs2-105068850_PTro_040520.f in contig hs2-105068850_HSap-Contig at consensus positions 295-299. 265) DEFINING KEYS (HOTKEYS) TO CALL EXTERNAL PROGRAMS AND/OR APPLY TAGS AND/OR INTEGRATE CONSED WITH EXTERNAL DATABASES [CUSTOM KEYS, USER-DEFINED KEYS] You can define keys (such as Control-N) to apply a particular tag to a single base, saving you the several steps in applying tags: swiping and selecting a tag type (as shown under "TAGS" above). However, it is even more powerful than that. You can also define an external program to run when you type this key. That external program can be your own, and it could be, for example, a program that puts information into an external database. The first thing you need to set up a custom hotkey is a .consedrc file which goes in edit_dir of the project you're working on (see above CONSED CUSTOMIZATION for other possible locations). Put the following in that file: consed.userDefinedKeys: 14 15 ! make a space-separated list of the decimal ASCII values of the keys ! 14 means control-N, 15 means control-O consed.programsForUserDefinedKeys: /bin/echo /bin/echo ! a space-separated list of the full pathnames of the commands to run consed.argumentsToPassToUserDefinedPrograms: argument_for_first_key argument_for_se cond_key ! a space-separated list of the arguments to pass to each user-defined programs consed.tagsToApplyWithUserDefinedKeys: none polymorphismConfirmed ! a space-separate list of the tag types to apply when the user ! presses a user-defined key. If a key is to have no associated tag, ! then enter "none" for that key. This makes control-N and control-O ("oh"--not zero) call "/bin/echo" by default. In either the aligned reads window or the trace window, click the cursor on a base and try these keys (e.g., holding down the control key and typing 'o'). Watch in the xterm where you started Consed for output like this: argument_for_first_key djs74-561.s1 97 Contig1 2534 2581 a 51 /kw3/gordon/consed_demo/standard/edit_dir/standard.fasta.screen.ace.1 tr.window argument_for_second_key djs74-2679.s1 78 Contig1 2527 2574 c 39 /kw3/gordon/consed_demo/standard/edit_dir/standard.fasta.screen.ace.1 a.r.window djs74_561.s1 the read the user was viewing (or "consensus" if the cursor is on the consensus) 97 the base position in the direction of sequencing (or -1 if the cursor is on the consensus) Contig1 the contig 2534 the unpadded consensus position 2581 is the padded (counts *'s) consensus position 'a' is the base 51 is the quality of the base /kw3/gordon/consed_demo/standard/edit_dir/standard.fasta.screen.ace.1 is the ace file tr.window means it was called by the user pushing the key in the trace window--not the aligned reads window. It's the same as if you had run the program from the shell, with command-line arguments, like this: bash%: /bin/echo argument_for_first_key djs74-561.s1 97 Contig1 2534 2581 a 51 /kw3/gordon/consed_demo/standard/edit_dir/standard.fasta.screen.ace.1 tr.window You will also see that control-O will automatically add a polymorphismConfirmed tag, but control-N will not add any tag. That is because of consed.tagsToApplyWithUserDefinedKeys (see above). Several groups that are doing polymorphism detection have expressed interest in this feature because it enables them to have Consed directly write into an external database (e.g., Oracle or Sybase) by calling a program that then writes to the database. You can use these hotkeys from within the trace window or the aligned reads window. You don't have to use only ctrl-N/ctrl-O... for instance 1 is control-A, 2 is control-B, 3 is control-C, 4 is control-D, etc. If you want to pass this information to a database, you will need to know how to talk to your database, and either choose your hotkey to do it directly for you, or call another program that takes the parameters above and massages them into the format your database needs. control-A, control-E, and control-T already mean something in the aligned reads window, so those keys cannot be defined to be anything else. Typically control-C, control-S, and control-Q already mean something to the operating system so you can't use those, either. 266) READ PREFIXES You can create a file called readPrefixes.txt in edit_dir. This file contains a list of reads and prefixes for those reads. In the Aligned Reads Window, the Consed user will see those read prefixes in a column before the read names. This can be a very helpful feature for finishers. For example, these read prefixes can indicate to the finishers which templates are available to use for making finishing reads. The format of the file is: (readname) (read prefix) (color for read prefix) The read prefix and color for read prefix are optional. If you leave them out, you get '*' for the read prefix in blue. The consed parameters involving this feature are: consed.defaultReadPrefix: * consed.readPrefixesFile: readPrefixes.txt consed.maxCharsDisplayedForReadPrefix: 1 but you probably won't need to change them. 267) USING FILES CREATED ON WINDOWS OR WINDOWS NT. Don't. (E.g., phd files generated by a Beckman CEQ-2000.) These files initially had at end of line instead of . CONSED chokes every time it tries to read something from these phd files. If you must use these files, you must first convert them to UNIX format, which means stripping out the CR's and just having \n (decimal 10) separate lines. 268) CREATING YOUR OWN ACE FILES (INSTEAD OF ACE FILES CREATED BY PHRAP) Some people have tried creating their own ace files, try Consed on it, and when Consed starts up ok, they don't understand when later some feature in Consed doesn't work. This is because Consed does not check everything about an ace file when it starts up. If you are going to write software to create ace files, here is a partial list of Consed features you should check before you think your ace files are fine for Consed: assembly view restriction digest read all traces complement contig and then read all traces add new reads If all of these work properly, then your ace files are probably ok. -------------------------------------------------------------------------- MONITORS AND MICE FOR CONSED If your monitor is part of a Unix computer (a Sun, an HP, a DEC, an SGI, or a Linux box) or is an Xterminal, then you will have absolutely no problems. You must have 3 button mouse or 3 button emulation. 3 Button emulation is tricky since Consed uses all 3 buttons of the mouse and it also uses Control-Middle-Mouse-button, Shift-Middle-Mouse-Button and Control-Right-Mouse-Button. So if you are going to try to just use a 2 button mouse (or, God-forbid, a 1 button mouse), you should make sure that you can emulate each of those. Often, if you push the left and right mouse buttons at the same time, your X server will interpret that to be the middle mouse button. But you must consult your X emulator or X server to know what it will do--that is out of Consed's control. If your monitor is a PC running Windows or NT, then you must have an X emulator installed and running. X emulators include: Exceed, XWin32, Reflection X, and OpenNT. Any of these will work if configured correctly (and the 'correctly' is the key). I encourage you to use single window mode and then use a Unix window manager such as CDE, fvwm, or mwm. If your monitor is a MAC with macosx running, see NOTE TO MACOSX USERS (above). If your monitor is a MAC (pre-Macosx), then you must also have an X emulator, such as Exodus or MACX installed and running. You *must* use this emulator in single window mode, and then use a Unix window manager such as CDE, fvwm, or mwm. (If you don't use single window mode, Consed might crash in some circumstances.) -------------------------------------------------------------------------- AUTOFINISH AND PRIMER-PICKING PARAMETERS AND OTHER PARAMETERS Some of the parameters below are used by Autofinish, some by Consed's primer picker, and some by both. You should use the default values of these parameters unless you have a particular reason for changing them. The defaults have been chosen very carefully based on theory and experimentation and are the ones being used at the major genome centers. You can set these via the .consedrc file--see CONSED CUSTOMIZATION (above) In addition, for a particular Consed session, you interactively change many of these in the following manner: On the main window, point to 'Options', hold down the left mouse button and release on 'Primer Picking Preferences.' You can modify the parameter of interest and then click on 'Apply and Dismiss'. The new value of the parameter will be in affect only until you restart Consed. For the most current list, in the Consed Main Window, point to 'Info', hold down the left button, and release on 'Show Current Consed Parameters'. ! In the following, I have annotated the parameters with the following ! symbols: ! ! (YES) freely customize to your own site ! (OK) don't change unless you have a specific need and know what you ! are doing ! (NO) don't change this! ! ! ! ! parameters in the (YES) category: ! consed.defaultTagType: polymorphism RWCString ! when swiping the consensus in the Aligned Reads Window to create a ! tag, what is the default tag type to be added? ! (YES) consed.defaultTagOnConsensusNotReads: true bool ! when swiping the consensus in the Aligned Reads Window to create a ! tag, by default will the consensus be tagged or the reads be tagged? ! (YES) consed.autoFinishMinNumberOfErrorsFixedByAnExp: 0.02 double ! if an experiment solves fewer errors than this, it isn't worth doing ! so won't be chosen. This parameter controls when Autofinish stops ! choosing experiments. ! (YES) consed.autoFinishRedundancy: 2.0 double ! This number should be between 1.0 and 2.0 If you want more reads ! for each area, increase the number towards 2.0 If you want fewer ! reads per area, decrease it towards 1.0. This only affects ! universal primer reads--not custom primer reads. ! ! (YES) consed.autoFinishAverageInsertSize: 1500 int ! If a template has a forward but no reverse, when deciding whether to ! allow this template for a particular primer or reverse, we need to ! make an assumption of where is the end of the template. If we have ! do not have enough forward/reverse pairs to determine the mean, then ! this parameter is used. ! (YES) consed.primersMaxInsertSizeOfASubclone: 3000 int // for checking for false-annealing ! check +/- this distance from the primer for false-annealing ! and check at most this distance for templates for a primer. ! Thus if you have more than one library, make this the max of ! all libraries. ! (YES) consed.primersMaxMeltingTemp: 60 int ! (YES) consed.primersMaxMeltingTempForPCR: 58 int ! Note: the difference between consed.primersMaxMeltingTempForPCR and ! consed.primersMinMeltingTempForPCR must be less than or equal to ! consed.primersMaxMeltingTempDifferenceForPCR ! Otherwise, autofinish may take forever to pick pcr primers. ! (YES) consed.primersPickTemplatesForPrimers: true bool ! when picking primers for subclone templates, pick templates also. ! If there is no suitable template for a primer, do not pick the ! primer. If you like to pick your own templates, you might want to ! turn this off for a little improvement in speed. ! This has no effect on Autofinish--just on interactive primer picking ! in Consed. ! (YES) consed.primersSubcloneFullPathnameOfFileOfSequencesForScreening: $CONSED_HOME/lib/screenLibs/primerSubcloneScreen.seq RWCString ! vector sequence file if choosing subclone (e.g., M13, plasmid) ! templates ! (YES) consed.primersCloneFullPathnameOfFileOfSequencesForScreening: $CONSED_HOME/lib/screenLibs/primerCloneScreen.seq RWCString ! vector sequence file if choosing clone (e.g., cosmid, BAC) template ! (YES) consed.primersMinMeltingTemp: 55 int ! (YES) consed.primersMinMeltingTempForPCR: 55 int ! (YES) consed.searchFunctionsUseUnalignedEndsOfReads: false bool ! when navigating by ! searchForSingleSubcloneRegions and searchForSingleStrandedRegions, ! and the read below has both aligned and unaligned portions, which ! bases of the read are considered to cover the region: ! uuuuuuuAAAAAAAAAAAAAAAAAAAAAAAAAuuuuuuuu ! <--------- if "true" ------------------> ! <-----if "false"--------> ! where u means an unaligned base and A means an aligned base ! (YES) consed.searchFunctionsUseLowQualityEndsOfReads: true bool ! when navigating by ! searchForSingleSubcloneRegions and searchForSingleStrandedRegions, ! and the read below has both low quality and high quality portions, ! which portions of the read are considered to cover the region: ! lllllllAAAAAAAAAAAAAAAAAAAAAAAAAllllllll ! <--------- if "true" ------------------> ! <-----if "false"--------> ! where l means a low quality base and A means a high quality base ! (YES) consed.inexactSearchForStringMaxPerCentMismatch: 5 int ! when using the inexact search for string, allow up to this ! % mismatch: the sum of the insertion, deletion, and substitution ! differences divided by the length of the query string ! (YES) consed.onlyAllowOneReadWriteConsedAtATime: false bool ! if there is another read-write consed (or Autofinish) process running in the ! same directory, and this consed (or Autofinish) is not read-only, ! then terminate with an error message ! (YES) consed.autoFinishAllowHighQualityDiscrepanciesInTemplateIfConsistentForwardReversePair: true bool ! otherwise, a single serious hqd will cause the template to be rejected. ! (YES) consed.printWindowCommand: /usr/bin/X11/xwd | /usr/bin/X11/xpr | /bin/lp -dlevulose RWCString ! system command to print out a Consed Window ! (YES) consed.fileOfTagTypes: FileName ! pathname of a file with the following format: ! (tag name) (color for displaying) (consensus or read or both) (yes/no) ! where "consensus" or "read" or "both" indicates whether the tag ! is available for the user to add to the consensus, to reads, or to ! both, and "yes" or "no" indicates whether the tag can be created ! in Consed by swiping, or whether it only can be created by an ! external program and displayed by Consed. ! (YES) consed.assemblyViewShowConsistentFwdRevPairs: false bool ! too many squares! See assemblyViewShowConsistentFwdRevPairDepth ! (YES) consed.assemblyViewShowConsistentFwdRevPairDepth: true bool ! This actually shows more information than ! assemblyViewShowConsistentFwdRevPairs and is much easier to read ! (YES) consed.assemblyViewShowConsistentFwdRevPairsBetweenDifferentScaffolds: true bool ! Lone links from the end of one contig to the end of another, but not ! confirmed by another in order to make the contigs joined into a scaffold. ! (YES) consed.assemblyViewShowLegsOnSquaresForConsistentFwdRevPairs: false bool ! This is even more cluttered than assemblyViewShowConsistentFwdRevPairs ! (YES) consed.assemblyViewShowGapSpanningFwdRevPairs: true bool ! This shows gap-spanning fwd/rev pairs that caused the contigs to ! be joined into a scaffold. ! (YES) consed.assemblyViewShowWhichInconsistentFwdRevPairs: filtered RWCString ! choices are: filtered, none, all ! "filtered" means that an inconsistent fwd/rev pair is only shown ! if it is confirmed by another inconsistent fwd/rev pair ! If all, full of red lines. If filtered, then only red lines that are ! confirmed by other red lines are shown. ! (YES) consed.assemblyViewShowReadDepth: true bool ! If true, read depth is shown in assemblyView ! (YES) consed.assemblyViewShowRestrictionDigestCutSites: true bool ! If true, and you open a Digest Window in Consed and you open ! the Assembly View window in Consed, the restriction digest cut ! sites will be shown in Assembly View (in addition to showing them in ! the Digest Window) ! (YES) consed.assemblyViewFilterSequenceMatchesBySize: false bool ! only show sequence matches if they fall between ! consed.assemblyViewSequenceMatchesMinSize and ! consed.assemblyViewSequenceMatchesMaxSize ! (YES) consed.assemblyViewSequenceMatchesMinSize: 100 int ! if consed.assemblyViewFilterSequenceMatchesBySize is true, ! then only show sequence matches that are larger than this ! (YES) consed.assemblyViewSequenceMatchesMaxSize: 10000 int ! if consed.assemblyViewFilterSequenceMatchesBySize is true, ! then only show sequence matches that are smaller than this ! (YES) consed.assemblyViewAutomaticallyStartWithConsed: false bool ! when consed starts, start assembly view. This only works if you ! specify the ace file on the command line. ! (YES) consed.assemblyViewDisplayTheseTagTypesOnTheseLines: edit 0 matchElsewhereHighQual 1 matchElsewhereLowQual 2 RWCString ! space-separated list of form: ! (tagtype) (line number) (tagtype) (line number) ! where line number is where in Assembly View the tag will be displayed ! (YES) consed.assemblyViewShowTags: true bool ! If true, and some tag types are selected, these tags ! will be shown in assemblyView. If false, no tags ! will be shown in assemblyView. ! (YES) consed.autoEditRecalculateHighQualitySegmentsOfReads: false bool ! If true, will recalculate the high quality segments of the reads ! (YES) consed.autoEditConvertCloneEndBasesToXs: true bool ! If true, will convert to X's bases of all reads that protrude beyond a ! cloneEnd tag. ! (YES) consed.autoEditTellPhrapNotToOverlapMultiplyDiscrepantReads: true bool ! This will find all locations where there are multiple identical ! discrepancies with the consensus (and some other conditions) and try ! to make most of the reads quality 99 at that location so that phrap, ! next time it is run, will not overlap those reads. This will fix ! many misassemblies. ! (YES) consed.autoEditTagEditableLowConsensusQualityRegions: true bool ! This will find regions that are low quality, but that a human ! finisher could easily determine the correct base and thus ! money could be saved by not having Autofinish suggest additional ! reads overlapping the region ! (YES) consed.autoEditMakeFakeRead: false bool ! takes a list of reads and makes a false read that consists of the ! combination of those reads (using the consensus to fill in between ! them) ! (YES) consed.autoEditMakeFakeReadFromRead1: read1 RWCString ! read 1 from which to make the fake read consed.autoEditMakeFakeReadFromRead2: read2 RWCString ! read 2 from which to make the fake read consed.autoEditMakeFakeReadName: mama RWCString ! name of fake read consed.autoEditMakeFakeReadFastaFilename: mama.fa FileName ! name of fasta file to put the read into consed.autoEditMergeAssembly: false bool ! This is used to take 2 assemblies (each with a single contig) that ! have a read in common and merge them into a single assembly with a ! single contig as follows: It reads consed.autoEditSecondaryAceFile ! into a secondary assembly and finds read ! consed.autoEditMakeFakeReadName within that secondary assembly as well ! as within the primary assembly. It assumes that these reads have the ! same unpadded bases (although they may have different pads). It ! equalizes the pads, and then moves the other reads (which are ! typically the fwd/rev pair of reads) from the secondary assembly into ! the primary assembly. It then deletes the secondary assembly and ! deletes consed.autoEditMakeFakeReadName from the primary assembly. ! (YES) consed.autoEditSecondaryAceFile: mama.ace FileName ! ace file of the fake read and the forward/reverse pair consed.showAllTracesJustShowGoodTraces: true bool ! Just show traces where there is a base at the cursor and ! there is trace signal at the cursor and where ! there is no "dataNeeded" tag at the cursor as specified by ! consed.showAllTracesDoNotShowTraceIfTheseTagsPresent ! (YES) consed.addAlignedSequenceQualityOfBases: 40 int ! when running consed -addAlignedSequence, what quality should the ! bases be? ! (YES) consed.makeLightBackgroundInAlignedReadsWindowAndTracesWindow: false bool ! for printing screens, saves toner ! (YES) ! ! ! parameters in the (OK) category: ! ! ! consed.autoReportPrintScaffolds: false bool ! (OK) consed.numberUnpaddedConsensusAtUserDefined: true bool ! allow user to put a tag on the consensus to specify the number to ! start numbering the consensus. ! Must use tag consed.tagColorStartNumberingConsensus as the ! tag with the number in it. ! (OK) consed.autoReportPrintHighQualityDiscrepancies: false bool ! (OK) consed.autoReportHighQualityDiscrepanciesExcludeCompressionOrG_dropoutTags: true bool ! used in connection with consed.autoReportPrintHighQualityDiscrepancies ! (OK) consed.autoReportHighQualityDiscrepanciesExcludeMostPads: true bool ! used in connection with consed.autoReportPrintHighQualityDiscrepancies ! Excludes high quality discrepancy pads except those in cases such as this: ! consensus aa ! read 1 *a ! read 2 *a ! read 3 a* ! read 4 a* ! (OK) consed.autoReportPrintLowConsensusQualityRegions: false bool ! (OK) consed.autoReportPrintSingleSubcloneRegions: false bool ! (OK) consed.autoReportPrintSingleStrandedRegions: false bool ! (OK) consed.autoReportPrintLinkingForwardReversePairs: false bool ! (OK) consed.autoReportPrintFilteredInconsistentForwardReversePairs: false bool ! (OK) consed.showAllTracesDoNotShowTraceIfTheseTagsPresent: dataNeeded RWCString ! See consed.showAllTracesJustShowGoodTraces ! (OK) consed.nameOfFakeJoiningReadsIncludesAceFileName: false bool ! This is useful if the user is going to combine the reads ! from a number of different ace files together. ! (OK) consed.whenUserScrollsOffWindowMillisecondsBetweenScrolling: 250 int ! (OK) consed.whenUserScrollsOffWindowBasesToScrollEachTime: 15 int ! (OK) consed.compareContigsUseBandedRatherThanFullSmithWaterman: true bool ! (OK) consed.compareContigsBandSize: 50 int ! band size of banded Smith Waterman ! (OK) consed.assemblyViewShowFwdRevPairDepthsInRedIfOnlyThisMany: 1 int ! (OK) consed.assemblyViewShowSequenceMatches: true bool ! When false, do not show any sequence matches (repeats) ! at all in Assembly View. ! Some people like to start out this way since displaying sequence ! matches slows down scrolling. ! (OK) consed.assemblyViewOKToShowSequenceMatchesBetweenContigs: true bool ! (OK) consed.assemblyViewOKToShowSequenceMatchesWithinContigs: true bool ! (OK) consed.assemblyViewOKToShowDirectSequenceMatches: true bool ! This means in which neither copy must be complemented with respect ! to the way it is in the scaffold as created by Consed. ! (OK) consed.assemblyViewOKToShowInvertedSequenceMatches: true bool ! This means that exactly one copy must be complemented with respect ! to the way it is in the scaffold as created by Consed. ! (OK) consed.assemblyViewOnlyShowSequenceMatchesToAParticularRegion: false bool ! You must set consed.assemblyViewOnlyShowSequencematchesToThisContig ! consed.assemblyViewOnlyShowSequenceMatchesToThisRegionLeft ! consed.assemblyViewOnlyShowSequenceMatchesToThisRegionRight ! (OK) consed.assemblyViewOnlyShowSequenceMatchesToThisContig: RWCString ! You must make ! consed.assemblyViewOnlyShowSequenceMatchesToAParticularRegion: true ! (OK) consed.assemblyViewOnlyShowSequenceMatchesToThisRegionLeft: 0 int ! consed.assemblyViewOnlyShowSequenceMatchesToAParticularRegion: true ! (OK) consed.assemblyViewOnlyShowSequenceMatchesToThisRegionRight: 0 int ! consed.assemblyViewOnlyShowSequenceMatchesToAParticularRegion: true ! (OK) consed.assemblyViewOnlyShowSequenceMatchesToEndsOfContigs: false bool ! (OK) consed.assemblyViewOnlyShowSequenceMatchesToEndsOfContigsThisFar: 1000 int ! This many base pairs from the end of the contig. ! (OK) consed.defaultReadPrefix: * RWCString ! This is used as the character to prefix reads with when the ! read is in consed.readPrefixesFile and the prefix is not specified. ! (OK) consed.readPrefixesFile: readPrefixes.txt FileName ! This file should contain a list of reads that you would want to ! have prefixes in the Aligned Reads Window. Each line should ! have the following format: ! (read name) (prefix) (color) ! The prefix and color are optional. You can have a line like this: ! (read name) (prefix) ! or this: ! (read name) ! but not this: ! (read name) (color) ! If the color is not specified, the color will default to ! consed.colorReadPrefixes: blue ! If the prefix is not specified, it will default to ! (OK) consed.maxCharsDisplayedForReadPrefix: 1 int ! It is still ok to have long read prefixes in the file ! consed.readPrefixesFile but only this many characters ! will be displayed in the Aligned Reads window ! (OK) consed.autoFinishDoNotDoPCRIfThisManyAvailableGapSpanningTemplates: 2 int ! (OK) consed.autoFinishDoNotDoUnorientedPCRIfThisManyOrMoreUnorientedPCRReactions: 6 int ! "unoriented" pcr reactions means cases in which autofinish is suggesting ! a pcr reaction to span a gap, but it doesn't know whether the 2 contig ends ! really go together since there are not enough (or no)templates that span ! that gap ! (OK) consed.autoFinishDoNotDoOrientedPCRIfGapSizeLargerThanThis: 10000 int ! Gap size can be specified in user-defined contigEndPair tags in a ! gap_size: field ! If the gap size is greater than this number, do not do PCR. ! (OK) consed.autoFinishDoNotDoPCRIfEndIsExtendedByReads: false bool ! If this is true, and autofinish was able to walk off the end of a ! contig, do not do PCR with that end of the contig. ! ! (OK) consed.autoFinishMaxAcceptableErrorsPerMegabase: 0 int ! target error rate. This parameter used to be the one that stopped ! Autofinish from calling more reads. However, consider a BAC that is ! nearly perfect except for one region with 3 quality 10 bases in a ! row. In this case the global errors per megabase is very ! low--perhaps lower than 1 error per megabase. Despite this, most ! labs would like to do one more read to fix this problem. Thus we ! set this parameter to zero (to disable it) so Autofinish will use ! the parameter consed.autoFinishMinNumberOfErrorsFixedByAnExp to stop ! calling more reads--it is a local error rate. ! (OK) consed.autoFinishIfNotEnoughFwdRevPairsUseThisPerCentOfInsertSize: 90 int ! If a template has a forward but no reverse, when deciding whether to ! allow this template for a particular primer, we need to make an assumption ! of where is the end of the template. If the template comes from a library ! with insert size 1500, it would be reasonable to assume that the end of ! template will be 1500 bases from the forward read. But if this template ! has an insert that is shorter than average, the walk may walk into vector. ! To be conservative, we may want to assume that the insert is somewhat ! shorter than average. By default, we assume that it is 90% as large as ! the average. This parameter gives that percentage. This parameter ! is used both by Consed and Autofinish. ! (OK) consed.primersNumberOfBasesToBackUpToStartLooking: 50 int ! e.g., if this is 50 and you want a read at position 1000, primers ! will be searched before base 950 but not in the region 950 to 1000 ! This has no effect on Autofinish--just on interactively picking primers. ! (OK) consed.primersMakePCRPrimersThisManyBasesBackFromEndOfHighQualitySegment: 100 int ! When a PCR product is made, you want it to overlap by this many bases ! the high quality part of the existing consensus. Thus choose PCR ! primers this many bases back (or more) ! (OK) consed.primersOKToChoosePrimersInSingleSubcloneRegion: true bool ! (OK) consed.primersOKToChoosePrimersWhereHighQualityDiscrepancies: false bool ! (OK) consed.primersOKToChoosePrimersWhereUnalignedHighQualityRegion: false bool ! (OK) consed.autoFinishCallReversesToFlankGaps: true bool ! if there is a forward-reverse pair flanking a gap, print it out ! if there is not, suggest reverses to flank the gap ! (OK) consed.autoFinishAllowWholeCloneReads: false bool ! ok to call reads whose template for sequencing reaction is the ! entire clone (BAC or cosmid) ! (OK) consed.autoFinishAllowCustomPrimerSubcloneReads: true bool ! ok to call reads with custom primers and subclone template ! (OK) consed.autoFinishAllowResequencingReads: true bool ! This is just universal primer reads to be resequenced using ! dye terminator chemistry or special chemistry. (It does not ! mean resequencing a custom primer read.) ! (OK) consed.autoFinishAllowResequencingReadsOnlyForRunsAndStops: false bool ! This parameter only has any effect when ! consed.autoFinishAllowResequencingReads is set to true. In that ! case no resequencing reads will be suggested, unless it is to cross ! a run or stop and special chemistry is suggested. ! (OK) consed.autoFinishAllowDeNovoUniversalPrimerSubcloneReads: true bool ! Allows calling reverse when there is just a forward. ! Allows calling a forward when there is just a reverse. ! (OK) consed.autoFinishAllowMinilibraries: false bool ! Allows calling minilibraries (shatter libraries or transposon ! libraries) of subclone templates for closing gaps ! (OK) consed.autoFinishAllowPCR: true bool ! Allows calling PCR for closing gaps, but only as a last resort ! (OK) consed.autoFinishAllowUnorientedPCRReactions: true bool ! Allows calling PCR amongst contig-ends that have insufficient ! fwd/rev pair linkage to any other contig-end. Thus it suggests ! pcr amongst all such contig-ends. ! To allow this type of pcr, you must also make: ! consed.autoFinishAllowPCRForUnorientedContigEnds: true ! See also: ! consed.autoFinishDoNotDoUnorientedPCRIfThisManyOrMoreUnorientedPCRReactions: ! which gives you finer control over unoriented pcr. ! (OK) consed.autoFinishAllowResequencingAUniversalPrimerAutofinishRead: false bool ! if Autofinish suggests a de novo universal primer read, ! do not allow Autofinish to suggest a resequence of this read ! (OK) consed.autoFinishAlwaysCloseGapsUsingMinilibraries: false bool ! "Minilibraries" includes transposing a subclone template or ! making a shatter library from a subclone template ! (OK) consed.autoFinishMaximumFinishingReadLength: 2000 int ! Change this only if your finishing reads are typically shorter ! than your shotgun reads. Otherwise, leave it unrealistically long, ! and Autofinish will set its model read based on your existing ! shotgun reads. ! (OK) consed.autoFinishSuggestMinilibraryIfGapThisManyBasesOrLarger: 800 int ! (OK) consed.autoFinishSuggestSpecialChemistryForRunsAndStops: true bool ! Suggest special chemistry such as dGTP for reads that cross ! mononucleotide or dinucleotide repeats that cause reads to fail or ! stops (structure) that cause reads to fail and thus dye terminator ! reads won't work. ! (OK) consed.autoFinishSuggestThisManyMinilibrariesPerGap: 2 int ! (OK) consed.primersWindowSizeInLooking: 450 int ! e.g., if this is 300, with example above, primers will be searched ! from base 650 to 950. This has no effect on Autofinish--it is just ! used for interactive primer picking in Consed. ! (OK) consed.primersAssumeTemplatesAreDoubleStrandedUnlessSpecified: false bool ! you can put the template type in the phd file in a WR template item ! consed will have a list of these and know which are single and ! double stranded ! (OK) consed.alignedReadsWindowInitialCharsWide: 60 int ! initial width of the aligned reads window including the read name and ! the bases ! (OK) consed.alignedReadsWindowInitialCharsHigh: 20 int ! initial height of the aligned reads window area where the consensus ! and reads are ! (OK) consed.alignedReadsWindowMaxCharsForReadNames: 20 int ! how many columns are reserved for read names ! (OK) consed.alignedReadsWindowAutomaticallyExpandRoomForReadNames: true bool ! If true, expand and contract space for read names, but don't ! contract less than consed.alignedReadsWindowMaxCharsForReadNames. ! If false, then always use ! consed.alignedReadsWindowMaxCharsForReadNames ! for space reserved for read names. ! (OK) consed.autoFinishAllowResequencingReadsToExtendContigs: false bool ! if false, a resequencing read is not called to extend a contig--only ! custom primer reads and de novo universal primer reads are called ! for this purpose. ! (OK) consed.autoFinishCallHowManyReversesToFlankGaps: 2 int ! This has two purposes: 1) it specifies how many forward/reverse ! pairs should be present for Consed/Autofinish to be certain of the ! order/ orientation of two contigs. If there are this many fwd/rev ! pairs flanking a gap, Autofinish will print out the contig ends that ! flank the gap. 2) If consed.autoFinishCallReversesToFlankGaps is ! set to true, and there are less than this many fwd/rev pairs ! flanking a gap, Autofinish will suggest additional reverses until ! there are this many. ! (OK) consed.autoFinishCloseGaps: true bool ! this allows you to turn off choosing reads to close gaps ! (OK) consed.autoFinishContinueEvenThoughReadInfoDoesNotMakeSense: false bool ! this allows you to override the checks that autofinish makes on the ! read info, such as checking there are not more than 5 or so reads ! from the same subclone template ! (OK) consed.autoFinishCostOfResequencingUniversalPrimerSubcloneReaction: 20.0 double ! compares universal primer subclone reaction, custom primer subclone ! reaction, and custom primer clone reaction to decide which to favor ! (OK) consed.autoFinishCostOfCustomPrimerSubcloneReaction: 60.0 double ! see above ! (OK) consed.autoFinishCostOfCustomPrimerCloneReaction: 80.0 double ! see above ! (OK) consed.autoFinishCostOfDeNovoUniversalPrimerSubcloneReaction: 60.0 double ! cost of reverse where there is only a forward or cost of forward ! when there is only a reverse ! (OK) consed.autoFinishCostOfMinilibrary: 500.0 double ! cost of making a minilibrary (transposon library or shatter library) ! from a subclone template ! (OK) consed.autoFinishCoverSingleSubcloneRegions: true bool ! this allows you to turn off choosing reads to cover single subclone regions ! (OK) consed.autoFinishCoverLowConsensusQualityRegions: true bool ! this allows you to turn off choosing reads to cover low consensus ! quality regions ! (OK) consed.autoFinishDebugUniversalPrimerReadsFile: gordon_debug.txt FileName ! for debugging Autofinish ! put a file with this name in the same directory as the ace file ! format: ! fcalld09 fwd ! fgj74f01 rev ! (template name) (fwd or rev) ! (OK) consed.autoFinishDebugCustomPrimerReadsFile: debug_custom.txt FileName ! for debugging Autofinish ! put a file with this name in the same directory as the ace file ! format: ! cgggacctgg ! (primer in 5' to 3' orientation) ! (OK) consed.autoFinishDoNotAllowSubcloneCustomPrimerReadsCloserThanThisManyBases: 200 int ! see consed.autoFinishDoNotAllowSubcloneCustomPrimerReadsCloseTogether ! (OK) consed.autoFinishDoNotAllowWholeCloneCustomPrimerReadsCloserThanThisManyBases: 300 int ! see consed.autoFinishDoNotAllowWholeCloneCustomPrimerReadsCloseTogether ! (OK) consed.autoFinishDoNotFinishWhereTheseTagsAre: doNotFinish editable RWCString ! list of tag types separated by spaces. E.g., ! doNotFinish repeat ! tells autofinish that you are not interested in finishing in this region ! (OK) consed.autoFinishDoNotExtendContigsWhereTheseTagsAre: doNotFinish RWCString ! list of tag types separated by spaces. E.g., ! doNotFinish repeat ! tells autofinish that you do not want to extend the contig near this ! tag. If you do not want this feature, just leave the list empty. ! (OK) consed.autoFinishDoNotExtendContigsIfTagsAreThisCloseToContigEnd: 50 int ! Uses the list from consed.autoFinishDoNotExtendContigsWhereTheseTagsAre ! and checks if any of these tags are within this many bases of the end of ! the contig. If they are, does not extend the contig. ! (OK) consed.dumpContigOrderAndOrientationInfoToThisFile: FileName ! In the case of Consed (not autofinish or autoPCRAmplify), send the ! output to this file rather than stderr. If this name is blank, ! continue (in case of consed), to send output to stderr. ! (OK) consed.autoFinishDumpTemplates: false bool ! for debugging, this allows you to dump all information about the ! templates--insert locations ! (OK) consed.autoFinishExcludeContigIfOnlyThisManyReadsOrLess: 10 int ! (OK) consed.autoFinishExcludeContigIfDepthOfCoverageGreaterThanThis: 50.0 double ! To exclude contigs that are probably E. coli contamination ! "depth of coverage" is defined here to mean the sum of the read ! lengths (including low quality ends) divided by the contig length. ! (OK) consed.autoFinishExcludeContigIfThisManyBasesOrLess: 1000 int ! consed.autoFinishExcludeContigIfTooShort must be set to true for ! this to have any effect ! (OK) consed.autoFinishHowManyTemplatesYouIntendToUseForCustomPrimerSubcloneReactions: 3 int ! this tells autofinish which templates you are planning on using ! which is necessary to figure out which regions will still be single ! subclone regions ! (OK) consed.primersMinNumberOfTemplatesForPrimers: 1 int ! if there are fewer templates than this, the primer is rejected consed.autoFinishMinBaseOverlapBetweenAReadAndHighQualitySegmentOfConsensus: 70 int ! when extending the consensus, a read that is too far from the ! consensus will not be assembled by phrap with this contig and thus ! will not be useful for extending the consensus. This gives the ! minimum overlap of a read with the high quality segment of the ! consensus. As reads are picked, then additional reads may be picked ! further out. ! (OK) consed.autoFinishNumberOfVectorBasesAtBeginningOfAUniveralPrimerRead: 40 int ! used to figure out where the beginning of a reverse will be. Not ! important to be accurate because the insert size is so uncertain ! (OK) consed.autoFinishCDNANotGenomic: false bool ! If this is set to true, the whole clone is assumed to be cDNA and, ! rather than the normal method of detecting the end of the clone, ! Autofinish detects the end of the cDNA as follows: ! the user is expected to add whole read items of type 'template', ! with 'type: univ fwd' for the 5' end and 'type: univ rev' for the 3' ! end of the cDNA. ! (OK) consed.autoFinishConfidenceThatReadWillCoverSingleSubcloneRegion: 90 int ! Autofinish computes the per cent of existing reads are aligned at ! each base position. Typically, this number starts at around 0% at ! base position 1, rises to close to 100% at around base position 300, ! and then drops again to 0% at base position 800 or so. This number ! specifies how high the number must be for Autofinish to consider an ! Autofinish read to cover a single subclone region. ! (OK) consed.autoFinishPrintForwardOrReverseStrandWhenPrintingSubcloneTemplatesForCustomPrimerReads: true bool ! If this is true, then custom primer reads are printed out like this: ! tccagaaaactaattcaaaataatg,56,standard.2,->,2413,2413,3681,Contig1,9,djs74_690 (fwd),10,djs74_1803 (fwd),11,djs74_1861 (fwd) ! If this is false, then custom primer reads are printed out like this: ! tccagaaaactaattcaaaataatg,56,standard.2,->,2413,2413,3681,Contig1,9,djs74_690,10,djs74_1803,11,djs74_1861 ! The difference is the (fwd) or (rev) that indicates which strand of ! the subclone template is to be used. This is particularly important if ! you use M13 and thus must make the reverse strand. ! (OK) consed.autoFinishPrintMinilibrariesSummaryFile: false bool ! If this is true, Autofinish will print a file with name ! xxx.minilibraries just as it prints one as xxx.univReverses and ! xxx.univForwards ! (OK) consed.autoFinishNearGapsSuggestEachMissingReadOfReadPairs: true bool ! This is set to true to increase the chance of closing a gap. For ! every subclone template that has just one universal primer read ! (either just a forward or just a reverse) that might protrude off ! the end of the contig, Autofinish suggests the universal primer read ! off the opposite end of the subclone template. ! If this parameter is set false, then ! Autofinish may still choose some of these reads, but it won't ! necessarily choose them all. ! (OK) consed.autoFinishDoNotIgnoreLCQIfThisManyBasesFromEndOfContigForLCQTagger: 300 int ! Do not ignore low consensus quality bases if they are this many ! bases from the end of the contig. ! (OK) consed.checkIfTooManyWalks: true bool ! this just checks if the number of walks, pcr ends, and unknown reads ! exceeds 20% of the total number of reads. If this is exceeded, then ! a warning message is given. Typically, such a warning indicates ! that you have incorrectly customized determineReadTypes.perl ! (OK) consed.numberOfColumnsBeforeReadNameInAlignedReadsWindow: 1 int ! this is for displaying information about the whole read items, ! both from PHD files and from a file consed.compareContigsAlignsThisManyBasesMax: 2000 int ! (OK) consed.compressedChromatExtension: .gz RWCString ! (OK) consed.dimLowQualityEndsOfReads: true bool ! ! (OK) consed.dimUnalignedEndsOfReads: false bool ! (OK) consed.fakeReadsSpecifiedByFilenameExtension: true bool ! if this is true, then reads that end with .a[0-9]* or .c[0-9]* will ! be considered fake reads. Otherwise, fake reads will be indicated ! by a WR item in the PHD file. ! (OK) consed.fullPathnameOfAddReads2ConsedScript: $CONSED_HOME/bin/addReads2Consed.perl FileName ! (OK) consed.fullPathnameOfCrossMatch: $CONSED_HOME/bin/cross_match FileName ! (OK) consed.fullPathnameOfPhred: $CONSED_HOME/bin/phred FileName ! (OK) consed.fullPathnameOfMiniassemblyScript: $CONSED_HOME/bin/phredPhrap FileName ! If you are up-to-date with phredPhrap, this script serves both ! the purpose of assemblying the entire project, as well as making ! miniassemblies. The difference is whether phredPhrap has the ! -include_chromats option. ! (OK) consed.gunzipFullPath: /usr/local/bin/gunzip RWCString ! (OK) consed.hideSomeTagTypesAtStartup: false bool ! (OK) consed.maximumNumberOfTracesShown: 4 int ! (OK) consed.navigateAutomaticTracePopup: false bool ! (OK) consed.navigateAutomaticAllTracesPopup: false bool ! (OK) consed.primersMinimumLengthOfAPrimer: 15 int ! (OK) consed.primersMaximumLengthOfAPrimer: 25 int ! (OK) consed.primersMinimumLengthOfAPrimerForPCR: 18 int ! (OK) consed.primersMaximumLengthOfAPrimerForPCR: 30 int ! (OK) consed.primersMaxMeltingTempDifferenceForPCR: 3.0 double ! how large can the difference of melting temperatures be between ! two primers of a PCR primer pair ! (OK) consed.primersMaxPCRPrimerPairsToDisplay: 100000 int ! there is a limit here, because there could possibly be millions ! (OK) consed.primersCheckJustSomePCRPrimerPairsRatherThanAll: true bool ! If there are 1000 1st primers, and 1000 2nd primers, that gives ! a million pairs for Consed to check, which takes a long time. So ! instead, just check some of the pairs ! (OK) consed.primersNumberOfTemplatesToDisplayInFront: 2 int ! this shows the number of templates to show in the interactive primer ! picking window ! (OK) consed.primersMaxLengthOfMononucleotideRepeat: 4 int ! (OK) consed.primersBadLibrariesFile: badLibraries.txt FileName ! file of libraries, one per line ! If any template is from any one of these libraries, then ! consed/autofinish will not use this template for walking or ! suggesting any universal primer reads ! (OK) consed.primersLibrariesInfoFile: librariesInfo.txt FileName ! file of libraries, with one entry for each library of the following ! format: ! LIB{ ! name: library1 ! avgInsertSize: 3000 ! maxInsertSize: 5000 ! stranded: single ! cost: 600.0 ! } ! (OK) consed.primersBadTemplatesFile: badTemplates.txt FileName ! file of templates that you've tried, don't work, and you don't want to try ! again ! (OK) consed.primersChooseTemplatesByPositionInsteadOfQuality: true bool ! Templates for subclone custom primer walks can be chosen either on ! the basis of the quality of the template (as determined by the quality ! of existing reads from that template) or by the location of the end of ! the template. If this parameter is false, templates will be chosen ! based solely on quality. If this parameter is true, then templates ! with forward/reverse pairs will be picked first, followed by templates ! that have the beginning of the insert closest to the primer. ! (OK) consed.primersWhenChoosingATemplateMinPotentialReadLength: 350 int ! when choosing templates for a custom primer, only choose a template ! if the read can be chosen at least this long ! (OK) consed.primersWindowSizeInLookingForPCR: 2000 int ! will look this many bases back from the pointer when looking for a PCR ! primer. Used both interactively and for Autofinish (see ! getUnpaddedRangeForMakingPCRPrimers ) ! (OK) consed.qualityThresholdForFindingHighQualityDiscrepancies: 40 int ! (OK) consed.defaultVectorPathnameForRestrictionFragments: $CONSED_HOME/lib/screenLibs/singleVectorForRestrictionDigest.fasta FileName ! If you want to have the vector cut with the restriction ! enzymes, put the vector sequence in a file in fasta format ! and put a pathname to it here. ! (OK) consed.fileOfAdditionalRestrictionEnzymes: FileName ! If you want a restriction enzyme that is not in the huge list ! that comes with Consed, you can put additional enzymes in a file ! and put the full pathname of that file here. The file must be in ! the form: ! AatI AGGCCT ! where AatI is the name of the enzyme and AGGCCT is the recognized ! sequence. Do not include the cut site or any other information. ! There must be a single space separating them. ! (OK) consed.commonRestrictionEnzymes: BglII EcoRV NsiI HindIII BamHI XhoI PstI RWCString ! a space-separated list of enzymes. Make sure they match precisely ! those that are either defaults or in the file indicated by ! consed.fileOfAdditionalRestrictionEnzymes ! (OK) consed.defaultSelectedRestrictionEnzymes: EcoRV HindIII RWCString ! a space-separated list of enzymes that will initially be ! selected when the user pops open the list of restriction enzymes. ! Currently these must be from among the consed.commonRestrictionEnzymes ! (OK) consed.restrictionEnzymesActualFragmentsFile: fragSizes.txt FileName ! format like this: ! >EcoRV ! 2385 ! 2489 ! -1 ! >XhoIII ! 259 ! 3843 ! -1 ! (OK) consed.restrictionDigestInitialWindowSizeInTextRows: 45 int ! (OK) consed.restrictionDigestDoNoShowAreaOfFragmentsOverThisSize: 50000 int ! In the picture of the real and in-silico ! (OK) consed.showReadsAlphabetically: false bool ! (OK) consed.showReadsInAlignedReadsWindowOrderedByFile: false bool ! There are now 3 different ways to sort the reads in the Aligned ! Reads Window (top to bottom): ! 1) alphabetically in which case you should set: ! consed.showReadsAlphabetically: true ! consed.showReadsInAlignedReadsWindowOrderedByFile: false ! 2) by the left end of the reads in which case you should set: ! consed.showReadsAlphabetically: false ! consed.showReadsInAlignedReadsWindowOrderedByFile: false ! 3) by a file that specifies the order of the reads in which case you ! should set: ! consed.showReadsAlphabetically: false ! consed.showReadsInAlignedReadsWindowOrderedByFile: true ! It is an error to set: ! consed.showReadsAlphabetically: true ! consed.showReadsInAlignedReadsWindowOrderedByFile: true ! (OK) consed.showReadsInAlignedReadsWindowOrderedByThisFile: readOrder.txt FileName ! This file has one read name per line. Wildcards ('*') are allowed. ! E.g., ! ABX* ! myFavoriteRead.scf ! *.abi ! This means that all reads that start with ABX* will come first, ! followed by the single read myFavoriteRead.scf and then reads that end ! with .abi A read that doesn't meet any of these criteria (e.g., ! rs10469282 ) comes last. ! (OK) consed.showABIBasesInTraceWindow: false bool ! (OK) consed.tracesWindowInitialPixelHeight: 50 int ! (OK) consed.assemblyViewWindowInitialPixelHeight: 500 int ! (OK) consed.assemblyViewFileOfTemplatesToNotShow: doNotShowInAssemblyView.fof FileName ! (OK) consed.assemblyViewCrossMatchMinmatch: 30 int ! value of -minmatch to be passed to crossmatch ! (OK) consed.assemblyViewCrossMatchMinscore: 60 int ! value of -minscore to be passed to crossmatch ! (OK) consed.assemblyViewFindSequenceMatchesForConsedScript: $CONSED_HOME/bin/findSequenceMatchesForConsed.perl FileName ! script that generates the file that is used by Assembly View to ! show sequence matches ! (OK) consed.assemblyViewCrossmatchMinmatch: 50 int ! default value of -minmatch for running crossmatch with ! findSequenceMatchesForConsed.perl ! (OK) consed.assemblyViewCrossmatchMinscore: 50 int ! default value of -minscore for running crossmatch with ! findSequenceMatchesForConsed.perl ! (OK) consed.assemblyViewSequenceMatchesMinimumSimilarity: 90 int ! only show sequence matches if their simlarity is at least this ! value. This can be changed by the user within consed/assembly view/ ! by clicking on "What to show/Sequence Matches" ! (OK) consed.tracesWindowInitialPixelWidth: 800 int ! (OK) consed.assemblyViewWindowInitialPixelWidth: 800 int ! (OK) consed.automaticallyScaleTraces: true bool ! (OK) consed.automaticallyScaleTracesSamplePeakHeightFractionOfWindowHeight: 0.99 double ! (OK) consed.automaticallyScaleTracesSamplePeakPercentile: 100 int ! (OK) consed.verticalTraceMagnification: 30 int ! (OK) consed.userDefinedKeys: 14 15 RWCString ! make a space-separated list of the decimal ASCII values of the keys ! 14 means control-N, 15 means control-O ! (OK) consed.programsForUserDefinedKeys: /bin/echo /bin/echo RWCString ! a space-separated list of the full pathnames of the commands to run ! This goes with consed.userDefinedKeys ! (OK) consed.argumentsToPassToUserDefinedPrograms: argument_for_first_key argument_for_second_key RWCString ! a space-separated list of the arguments to pass to the user-defined programs ! This goes with consed.userDefinedKeys ! (OK) consed.tagsToApplyWithUserDefinedKeys: none polymorphismConfirmed RWCString ! a space-separate list of the tag types to apply when the user ! presses a user-defined key. If a key is to have no associated tag, ! then enter "none" for that key. ! This goes with consed.userDefinedKeys ! (OK) consed.listOfTagTypesToHide: matchElsewhereHighQual matchElsewhereLowQual RWCString ! (OK) consed.listOfOptionalWordsToSaveInListOfReadNames: forward reverse ET BigDye customOligo SeqEx FS dyePrimer dyeTerminator doubleStranded singleStranded RWCString ! (OK) consed.extendConsensusWithHighQuality: false bool ! When using "change consensus" to extend the consensus, make the ! read edited high quality. This will cause phrap, the next time ! the project is assembled, to similarly extend the consensus. If ! this is set to false, then do not change the quality of the read and ! extend the consensus with the original read qualities. ! (OK) consed.fastStartup: true bool ! If you have used makePhdBall.perl to create a huge file with all the ! xxx.phd.1 files, and you have enough memory on your computer, then ! you can startup up consed up to 7 times faster ! (OK) consed.fastStartupFile: phd.ball FileName ! If you have used makePhdBall.perl to create a huge file with all the ! xxx.phd.1 files, and you have enough memory on your computer, then ! you can startup up consed up to 7 times faster. This file gives ! the name of the huge file. ! (OK) consed.alwaysRunProgramToGetChromats: false bool ! This allows consed to get chromats out of a database, or do some ! other pre-processing of a chromat before reading it. If set to true, ! consed does not look in ../chromat_dir at all for the chromat, but ! rather runs the program listed in consed.programToRunToGetChromats ! with argument name-of-read and then reads the chromat out of ! consed.uncompressedChromatDirectory and then later deletes the ! chromat from consed.uncompressedChromatDirectory ! (OK) consed.programToRunToGetChromats: /usr/local/bin/myFavoriteProgram FileName ! Set this to the program or script that you want to use to ! get a chromat and put it into /tmp (or whatever you set ! consed.uncompressedChromatDirectory to) ! (OK) consed.autoFinishUseLongModelReadRatherThanShort: false bool ! When calculating the distribution of quality values at high read ! positions, should Autofinish assume that the reads that were this ! long and longer are representative of finishing reads, or should it ! assume that some finishing will not make it out this far in roughly ! the same proportion as the existing reads. ! (OK) consed.askAgainIfWantToQuitConsedIfThisManyReads: 5000 int ! If you have to wait a long time for consed to come up, don't ! quit out of consed by mistake. ! (OK) consed.printWindowInstructions: Make sure that the window you want to print is unobscured. Then click "Yes" to dismiss this box. Then click on the window you want to print. You will hear a beep immediately, then another beep a little later. Then the copy of the window should come off the printer specified by your environment variable LPDEST. RWCString ! (OK) consed.allowMultipleSearchForStringWindows: false bool ! If this is false, and there is already a SearchForString Window up, ! and the user clicks on SearchForString, it will be brought to the ! front, rather than another one being created. ! (OK) consed.autoPCRAmplifyFalseProductsOKIfLargerThanThis: 3000 int ! If a pcr primer pair matches somewhere else and creates a product ! larger than this, the pcr primer pair will still be acceptable ! since the product will not easily form in the cycle time. ! (OK) consed.autoPCRAmplifyMakePrimerOutOfFirstRegion: false bool ! I don't expect people will use this. It allows you to amplify a ! region using autoPCRAmplify not by allowing Consed to choose each ! primer (the normal case) but rather by fixing the first primer to be ! the first area bordering the region. I added this to allow ! non-specific priming to the transplice leader. ! (OK) consed.autoPCRAmplifyMaybeRejectPrimerIfThisCloseToDesiredProduct: 5000 int ! ---> ---> ! false true match ! In such a case, the primer pair will be rejected if the false is ! within 5000 bases of true, even if false is a false match of the ! other primer. ! ! <--- ---> ! false true match ! In this case, the primer pair will not be eliminated. ! (OK) consed.addNewReadsRecalculateConsensusQuality: true bool ! When running consed by ! consed -ace old_ace.ace -addReads fileOfPhdFiles.txt -newAceFilename new_ace.ace ! consensus quality is recalculated ! (OK) consed.addNewReadsPutReadIntoItsOwnContig: ifUnaligned RWCString ! choices are: ! "always" (just put each read into its own contig) ! "ifUnaligned" (put read into a contig if it aligns against the ! consensus, otherwise put it into its own contig) ! "never" (put read into a contig if it aligns against the consensus; ! otherwise do not put it into the assembly) ! (OK) consed.assemblyViewNumberOfRowsOfTags: 4 int ! (OK) consed.warnUserWhenTryingToEditAllReads: true bool ---------------------------------------------------------------------------- ACE FILE FORMAT Refer to the accompanying sample_ace_file.txt (below) AS CO <# of bases> <# of reads in contig> <# of base segments in contig> This defines the contig. The U or C indicates whether the contig has been complemented from the way phrap originally created it. Thus this is always U for an ace file created by phrap. The contig sequence follows. It includes pads--"*" characters which are inserted by phrap in order to make room for some read that has an extra base at that position. (Note: any position which counts the *'s is referred to as a "padded position". A position that does not count *'s is referred to as "unpadded position".) BQ This starts the list of base qualities for the unpadded consensus bases. (NB: annoyingly, no qualities are given for *'s in the consensus.) The contig is the one from the previous CO, hence no name is needed here. AF This defines the location of the read within the contig. C or U means complemented or uncomplemented. means the position of the beginning of the read, in terms of consensus bases which start at 1 and do count *'s. BS The BS line (base segment) indicates which read phrap has chosen to be the consensus at a particular position. If you are writing the ace file from an assembler other than phrap, and since most assemblers do not compute the consensus this way, you still must write BS lines for Consed's benefit. In this case, I suggest you choose any read which matches the consensus perfectly over the stretch of bases. There must not be any two BS lines that intersect. Each unpadded base must be included in some BS line. RD <# of padded bases> <# of whole read info items> <# of read tags> Below RD is the sequence of bases for the read. The sequence includes *'s and is in the orientation that phrap needed to align it against the consensus (thus it might be complemented from the direction it was sequenced). QA This line indicates which part of the read is the high quality segment (if there is any) and which part of the read is aligned against the consensus. These positions are offsets (and count *'s) from the left end of the read (left, as shown in Consed). Hence for bottom strand reads, the offsets are from the end of the read. The offsets are 1-based. That is, if the left-most base is in the aligned, high-quality region, = 1 and = 1 (not zero). If the entire read is low quality, then and will both be -1. DS CHROMAT_FILE: PHD_FILE: TIME: CHEM: DYE: TEMPLATE: